ID: 949216046

View in Genome Browser
Species Human (GRCh38)
Location 3:1568358-1568380
Sequence CCTAATAATCTGACAGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949216042_949216046 14 Left 949216042 3:1568321-1568343 CCTCTTCTGTGTACATTAACATT No data
Right 949216046 3:1568358-1568380 CCTAATAATCTGACAGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949216046 Original CRISPR CCTAATAATCTGACAGTGAA GGG Intergenic
No off target data available for this crispr