ID: 949217144

View in Genome Browser
Species Human (GRCh38)
Location 3:1583561-1583583
Sequence TGGGCTGTTCCAGGTGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949217144_949217152 19 Left 949217144 3:1583561-1583583 CCTGGAACACCTGGAACAGCCCA No data
Right 949217152 3:1583603-1583625 TTGAGACAAGTCCAGCTGGTTGG No data
949217144_949217151 15 Left 949217144 3:1583561-1583583 CCTGGAACACCTGGAACAGCCCA No data
Right 949217151 3:1583599-1583621 AGGCTTGAGACAAGTCCAGCTGG No data
949217144_949217153 20 Left 949217144 3:1583561-1583583 CCTGGAACACCTGGAACAGCCCA No data
Right 949217153 3:1583604-1583626 TGAGACAAGTCCAGCTGGTTGGG No data
949217144_949217148 -5 Left 949217144 3:1583561-1583583 CCTGGAACACCTGGAACAGCCCA No data
Right 949217148 3:1583579-1583601 GCCCAGTAATCTGGGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949217144 Original CRISPR TGGGCTGTTCCAGGTGTTCC AGG (reversed) Intergenic
No off target data available for this crispr