ID: 949220156

View in Genome Browser
Species Human (GRCh38)
Location 3:1623188-1623210
Sequence CTGGACTGCTTTAGGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949220153_949220156 6 Left 949220153 3:1623159-1623181 CCATTTTGTTCATGTGGAACTTT No data
Right 949220156 3:1623188-1623210 CTGGACTGCTTTAGGAAAACAGG No data
949220151_949220156 29 Left 949220151 3:1623136-1623158 CCAGCTATTTAAACTAATTATTT No data
Right 949220156 3:1623188-1623210 CTGGACTGCTTTAGGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949220156 Original CRISPR CTGGACTGCTTTAGGAAAAC AGG Intergenic
No off target data available for this crispr