ID: 949231547

View in Genome Browser
Species Human (GRCh38)
Location 3:1756600-1756622
Sequence TGAAGCCCCAGTACATGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949231543_949231547 9 Left 949231543 3:1756568-1756590 CCCTCTGATGGCACCTGGCTGAT No data
Right 949231547 3:1756600-1756622 TGAAGCCCCAGTACATGAGAGGG No data
949231545_949231547 -4 Left 949231545 3:1756581-1756603 CCTGGCTGATAAAAGTGAATGAA No data
Right 949231547 3:1756600-1756622 TGAAGCCCCAGTACATGAGAGGG No data
949231542_949231547 10 Left 949231542 3:1756567-1756589 CCCCTCTGATGGCACCTGGCTGA No data
Right 949231547 3:1756600-1756622 TGAAGCCCCAGTACATGAGAGGG No data
949231544_949231547 8 Left 949231544 3:1756569-1756591 CCTCTGATGGCACCTGGCTGATA No data
Right 949231547 3:1756600-1756622 TGAAGCCCCAGTACATGAGAGGG No data
949231539_949231547 21 Left 949231539 3:1756556-1756578 CCAGCAAAGAGCCCCTCTGATGG No data
Right 949231547 3:1756600-1756622 TGAAGCCCCAGTACATGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949231547 Original CRISPR TGAAGCCCCAGTACATGAGA GGG Intergenic
No off target data available for this crispr