ID: 949237541

View in Genome Browser
Species Human (GRCh38)
Location 3:1828251-1828273
Sequence GTCCATATAAATAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949237541_949237544 -3 Left 949237541 3:1828251-1828273 CCATCCTCCTTATTTATATGGAC No data
Right 949237544 3:1828271-1828293 GACCATATATGTTATTTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949237541 Original CRISPR GTCCATATAAATAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr