ID: 949240109

View in Genome Browser
Species Human (GRCh38)
Location 3:1860948-1860970
Sequence ATATAATCACAGATGAACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949240109_949240110 12 Left 949240109 3:1860948-1860970 CCGAGGTTCATCTGTGATTATAT No data
Right 949240110 3:1860983-1861005 TCTCACGAAACTGAACCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949240109 Original CRISPR ATATAATCACAGATGAACCT CGG (reversed) Intergenic
No off target data available for this crispr