ID: 949245337

View in Genome Browser
Species Human (GRCh38)
Location 3:1920172-1920194
Sequence CTGCTACATATTTAGAATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949245335_949245337 -8 Left 949245335 3:1920157-1920179 CCAAATAAATACGACCTGCTACA No data
Right 949245337 3:1920172-1920194 CTGCTACATATTTAGAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949245337 Original CRISPR CTGCTACATATTTAGAATTC AGG Intergenic
No off target data available for this crispr