ID: 949247220

View in Genome Browser
Species Human (GRCh38)
Location 3:1939483-1939505
Sequence CAGGGTATGATGGCTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949247220_949247229 18 Left 949247220 3:1939483-1939505 CCAGCCCCAGCCATCATACCCTG No data
Right 949247229 3:1939524-1939546 TTGATGCTGTGTCTGCACCATGG No data
949247220_949247226 -5 Left 949247220 3:1939483-1939505 CCAGCCCCAGCCATCATACCCTG No data
Right 949247226 3:1939501-1939523 CCCTGCTGTTCATTGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949247220 Original CRISPR CAGGGTATGATGGCTGGGGC TGG (reversed) Intergenic
No off target data available for this crispr