ID: 949247220 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:1939483-1939505 |
| Sequence | CAGGGTATGATGGCTGGGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 949247220_949247229 | 18 | Left | 949247220 | 3:1939483-1939505 | CCAGCCCCAGCCATCATACCCTG | No data | ||
| Right | 949247229 | 3:1939524-1939546 | TTGATGCTGTGTCTGCACCATGG | No data | ||||
| 949247220_949247226 | -5 | Left | 949247220 | 3:1939483-1939505 | CCAGCCCCAGCCATCATACCCTG | No data | ||
| Right | 949247226 | 3:1939501-1939523 | CCCTGCTGTTCATTGCAGCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 949247220 | Original CRISPR | CAGGGTATGATGGCTGGGGC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||