ID: 949248998

View in Genome Browser
Species Human (GRCh38)
Location 3:1960131-1960153
Sequence CTGTGTAGTTGCATTTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949248998_949249001 28 Left 949248998 3:1960131-1960153 CCAAGATAAATGCAACTACACAG No data
Right 949249001 3:1960182-1960204 GAAGACTCTTGAGTAAAGACAGG No data
949248998_949249002 29 Left 949248998 3:1960131-1960153 CCAAGATAAATGCAACTACACAG No data
Right 949249002 3:1960183-1960205 AAGACTCTTGAGTAAAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949248998 Original CRISPR CTGTGTAGTTGCATTTATCT TGG (reversed) Intergenic
No off target data available for this crispr