ID: 949248998 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:1960131-1960153 |
| Sequence | CTGTGTAGTTGCATTTATCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 949248998_949249001 | 28 | Left | 949248998 | 3:1960131-1960153 | CCAAGATAAATGCAACTACACAG | No data | ||
| Right | 949249001 | 3:1960182-1960204 | GAAGACTCTTGAGTAAAGACAGG | No data | ||||
| 949248998_949249002 | 29 | Left | 949248998 | 3:1960131-1960153 | CCAAGATAAATGCAACTACACAG | No data | ||
| Right | 949249002 | 3:1960183-1960205 | AAGACTCTTGAGTAAAGACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 949248998 | Original CRISPR | CTGTGTAGTTGCATTTATCT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||