ID: 949252143

View in Genome Browser
Species Human (GRCh38)
Location 3:1998124-1998146
Sequence AGTATAAAAGACTTTGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949252141_949252143 25 Left 949252141 3:1998076-1998098 CCATATATCTAAACATATCTAAA No data
Right 949252143 3:1998124-1998146 AGTATAAAAGACTTTGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949252143 Original CRISPR AGTATAAAAGACTTTGTAGA TGG Intergenic
No off target data available for this crispr