ID: 949255000

View in Genome Browser
Species Human (GRCh38)
Location 3:2035543-2035565
Sequence GTGTGTGCACACATGTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949255000_949255001 9 Left 949255000 3:2035543-2035565 CCTCAGCACATGTGTGCACACAC No data
Right 949255001 3:2035575-2035597 CACACACACACAGTAGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949255000 Original CRISPR GTGTGTGCACACATGTGCTG AGG (reversed) Intergenic
No off target data available for this crispr