ID: 949255001

View in Genome Browser
Species Human (GRCh38)
Location 3:2035575-2035597
Sequence CACACACACACAGTAGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949255000_949255001 9 Left 949255000 3:2035543-2035565 CCTCAGCACATGTGTGCACACAC No data
Right 949255001 3:2035575-2035597 CACACACACACAGTAGCAAAAGG No data
949254999_949255001 12 Left 949254999 3:2035540-2035562 CCACCTCAGCACATGTGTGCACA No data
Right 949255001 3:2035575-2035597 CACACACACACAGTAGCAAAAGG No data
949254998_949255001 13 Left 949254998 3:2035539-2035561 CCCACCTCAGCACATGTGTGCAC No data
Right 949255001 3:2035575-2035597 CACACACACACAGTAGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949255001 Original CRISPR CACACACACACAGTAGCAAA AGG Intergenic
No off target data available for this crispr