ID: 949261950

View in Genome Browser
Species Human (GRCh38)
Location 3:2113135-2113157
Sequence CTCAATTGCCTGAATTATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949261950 Original CRISPR CTCAATTGCCTGAATTATCA GGG Intronic
901758508 1:11455845-11455867 CTTAATTTCCTTAAATATCAGGG + Intergenic
903808175 1:26020183-26020205 GTAATTTGCCTGAATTCTCACGG - Intronic
904244449 1:29176824-29176846 ATGAATAGCCTGAATTTTCAGGG - Intronic
907874858 1:58475747-58475769 CCCAATTCCCAGAATTATTATGG - Intronic
908453970 1:64283868-64283890 ATGAATGGCCTGAATTATTAGGG + Intergenic
909951960 1:81730813-81730835 TTCAATTATCTGAATTATTAAGG - Intronic
910912412 1:92251341-92251363 CTTAATTTACTGAATTATCTTGG - Intronic
912914259 1:113796446-113796468 CTCAGCTGCCTGAATTATAGTGG - Intronic
916041146 1:160962606-160962628 TTCCATTTCCTGAATTTTCAGGG - Intergenic
916461156 1:165026145-165026167 CTCATTATCCTGAATTATCCAGG + Intergenic
917786902 1:178468833-178468855 CTCAATTGCCTTATTTATCCAGG - Intronic
920214778 1:204354325-204354347 CTCTATTTCCTGAATTCACACGG + Intronic
923563637 1:235060406-235060428 CTCAGTTTCCTGATTTGTCATGG - Intergenic
1065901076 10:30208524-30208546 CTCAATTGCCTAGATTGTCCAGG - Intergenic
1067790246 10:49282394-49282416 CTCAAATGACTGAATTGTAAGGG + Intergenic
1068163604 10:53299743-53299765 CTCAATGTCATGAATCATCAGGG - Intergenic
1072227530 10:93384181-93384203 CTCAGCTGCCTGAATCATCGAGG - Intronic
1072809717 10:98450286-98450308 CTCCATTGGATTAATTATCATGG + Intergenic
1075931911 10:126304840-126304862 GTCAATTTCATGAAATATCAGGG + Intronic
1076244848 10:128938765-128938787 CTGAATTGTTTGAATTATTAAGG + Intergenic
1078415628 11:11162446-11162468 CTCCAGTGCCTTAGTTATCAGGG + Intergenic
1081147292 11:39578660-39578682 CTCAATTGCCTGTATATTTAGGG - Intergenic
1081333192 11:41829925-41829947 ATCAATTTTCTGAATCATCATGG - Intergenic
1082111443 11:48280253-48280275 CTCAATATCATTAATTATCAGGG - Intergenic
1082296647 11:50447996-50448018 CCCAATCTACTGAATTATCAGGG - Intergenic
1082749277 11:56999836-56999858 TTCAATTTCCAGAATTATCTGGG + Intergenic
1086747649 11:90450226-90450248 ATAAATTGCCTGAATTCTGATGG - Intergenic
1088398789 11:109399882-109399904 CTGAATTATCTGAATTCTCAAGG - Intergenic
1088627521 11:111741079-111741101 CACATTTTCCTGAATTATGATGG - Intronic
1089806864 11:121098217-121098239 TTCAAATGCCTGAATTACCATGG - Intergenic
1090084157 11:123636474-123636496 CTCAAGTGCCTGTAATATCAGGG - Intronic
1092086353 12:5765955-5765977 CTCAACTCCCTTAATCATCAGGG + Intronic
1093614481 12:21206386-21206408 CTCATTTTCCTGAATTCTGAGGG - Intronic
1094308597 12:29051655-29051677 CTCAATAGCATTAATTATCAAGG - Intergenic
1094625107 12:32115900-32115922 CCCAACTGCCTGAATCATCCTGG - Intronic
1099283638 12:80686805-80686827 ATCAATTGCTTGCATAATCAAGG + Intergenic
1100270629 12:93021129-93021151 CTGATTTGACTAAATTATCAAGG + Intergenic
1100518778 12:95353402-95353424 CTCAATTGCCTTAAATCCCAAGG + Intergenic
1100698886 12:97125041-97125063 CTCAATTGCCATAATTGTCTTGG - Intergenic
1100910736 12:99359215-99359237 ATCAAGTGCCTGAATTATAGAGG - Intronic
1101046443 12:100811089-100811111 GTCAATTTCTTGTATTATCAGGG - Intronic
1101974630 12:109346292-109346314 CTCAATTGCCTGATATAAAATGG - Intergenic
1103102054 12:118186064-118186086 CACAATTAGCTGAATTATTAGGG + Intronic
1109132761 13:58609835-58609857 CTCTAGTGCCTGGATTAGCATGG + Intergenic
1111471750 13:88692725-88692747 ATCAATTTCATGAATCATCAGGG - Intergenic
1111629553 13:90832491-90832513 ATAAATTGCCTGAGTTTTCAAGG - Intergenic
1114046291 14:18879471-18879493 CTCACCTGGCTAAATTATCAAGG + Intergenic
1114117920 14:19639979-19640001 CTCACCTGGCTAAATTATCAAGG - Intergenic
1115736458 14:36336332-36336354 ATGAATTGCTTGAATAATCAAGG + Intergenic
1202845396 14_GL000009v2_random:168204-168226 CTCTATTGCCTGCATTATGAAGG + Intergenic
1202914797 14_GL000194v1_random:158470-158492 CTCTATTGCCTGCATTATGAAGG + Intergenic
1202875392 14_GL000225v1_random:203029-203051 CTCTATTGCCTGTATTATGAAGG - Intergenic
1202877871 14_KI270722v1_random:24249-24271 CTCTATTGCCTGCATTATGAAGG - Intergenic
1123391573 15:19879817-19879839 CTAAATTGCTTGAATTTTAAGGG - Intergenic
1124803834 15:32861306-32861328 CTCTTTTGCCTGAATTCACAGGG + Intronic
1125102337 15:35928892-35928914 CTTAATTGCCTGAAGTTTTAAGG + Intergenic
1125156306 15:36590509-36590531 CAGAATTGCCTCAATTAGCAGGG - Intronic
1126324274 15:47459335-47459357 GTCAACTGCCTGAATGATCTGGG + Intronic
1129482274 15:75836926-75836948 CTCTCTTGCCTGTATTATAAAGG - Intergenic
1130701082 15:86182615-86182637 ATCAATTTCCTGAATATTCAAGG - Intronic
1130831322 15:87603994-87604016 TTCAATTGCCTTATTTAACAGGG + Intergenic
1130996269 15:88906098-88906120 CTCACTTTCCTTAATCATCATGG + Intronic
1131858501 15:96625795-96625817 CACCATTGCCTGAATTACCTGGG - Intergenic
1131966861 15:97853390-97853412 CTGAATTGCCTGAACTAAAAGGG + Intergenic
1133557989 16:6923811-6923833 GTCACTTGCCTGAAGTTTCATGG - Intronic
1144254331 17:13451360-13451382 CTCAATATCATTAATTATCAGGG + Intergenic
1144276831 17:13678192-13678214 CTCAATATCATTAATTATCAGGG + Intergenic
1147506368 17:41021533-41021555 GACAATAGCCTGAATTATCCAGG + Intergenic
1147507650 17:41035430-41035452 ATCAATTTGCTGAATTTTCACGG + Intergenic
1155839751 18:30630556-30630578 ATCAAATCCCTGATTTATCATGG + Intergenic
1157894284 18:51449171-51449193 CTGAATTGCCTGAATTGTCTGGG - Intergenic
1159163674 18:64675778-64675800 CTTAATTGCCAGATTTATCATGG - Intergenic
1160142056 18:76333927-76333949 CTCAACAGCGTGAATCATCAGGG + Intergenic
1164263677 19:23593380-23593402 CTCAATATCCCTAATTATCAGGG + Intronic
1164798680 19:31057797-31057819 CTCATTTGAATGAATTATTAAGG + Intergenic
1165971003 19:39629782-39629804 CTTAATTTCCAGAATTATCCAGG + Intergenic
1167979718 19:53263815-53263837 CTCAATTGCCTTAGTATTCAGGG + Intergenic
1202672807 1_KI270710v1_random:8684-8706 CTCTATTGCCTGCATTATGAAGG + Intergenic
926334609 2:11853831-11853853 CTGAATGGCCTGAATGTTCAGGG + Intergenic
926369456 2:12165278-12165300 CTCCTTTCCTTGAATTATCATGG + Intergenic
926384465 2:12322700-12322722 CTCAATGGCCTATATTATGATGG + Intergenic
926427394 2:12751575-12751597 TTAAAATGCCTGAATTATTACGG - Intergenic
927225608 2:20763079-20763101 CTCATTTCCTTGAATTATTAGGG - Intronic
929975594 2:46631455-46631477 CTCATTTGCCTAATTTATCTAGG - Intergenic
930247024 2:48994552-48994574 CTCCATTTCCTGTATTATCTTGG - Intronic
931107854 2:59076940-59076962 CTTCATTGCCTCAATTAGCATGG - Intergenic
931959426 2:67465785-67465807 CTAAACTGCATGAATTATCAAGG - Intergenic
932906831 2:75762867-75762889 CTCAGTTGACTTATTTATCAGGG - Intergenic
932925863 2:75973803-75973825 CTCAATTTCACTAATTATCAGGG + Intergenic
933474748 2:82775896-82775918 CTCAATATCATTAATTATCAGGG + Intergenic
937864067 2:126734896-126734918 CTCAATTGCCTAGATTAACTTGG + Intergenic
941404621 2:165073836-165073858 CTCCAGTCTCTGAATTATCAGGG - Intergenic
943604902 2:189965550-189965572 CTCAACAGCATGAATGATCAGGG + Intronic
943897797 2:193389162-193389184 CTTAATTGCCTATATAATCATGG - Intergenic
945633372 2:212313850-212313872 TTCAATCTCCTGAATCATCAAGG + Intronic
945782878 2:214198842-214198864 CTCAATATCCCTAATTATCAGGG - Intronic
946098295 2:217295143-217295165 CTCATTTTTCTGAAGTATCAAGG + Intronic
1169637209 20:7705720-7705742 CTCAATATCATTAATTATCAGGG - Intergenic
1172912497 20:38420386-38420408 TGCAATGCCCTGAATTATCATGG + Intergenic
1173599628 20:44284372-44284394 CTCATTTGCCTTAATTGGCAGGG - Intergenic
1176639160 21:9281706-9281728 CTCTATAGCCTGCATTATGAAGG - Intergenic
1177113382 21:17056168-17056190 CTCATTTGTCTGAATCATCTAGG + Intergenic
1180372467 22:12054537-12054559 CTCTATAGCCTGCATTATGAAGG - Intergenic
1180390004 22:12221125-12221147 CTCTATTGCCTGCAGTATGAAGG + Intergenic
1180415932 22:12713355-12713377 CTCTATTGCCTGCAGTATGAAGG - Intergenic
1180423207 22:12889195-12889217 CTCTATAGCCTGCATTATGAAGG - Intergenic
1180464828 22:15602107-15602129 CTCACCTGGCTAAATTATCAAGG + Intergenic
1182714915 22:32350214-32350236 CTCAGTTGACTGAATTATTTCGG - Intergenic
1185233089 22:49694513-49694535 CTCAGGTGCCTGAGTTATCTGGG + Intergenic
949261950 3:2113135-2113157 CTCAATTGCCTGAATTATCAGGG + Intronic
950996545 3:17504062-17504084 TTCAAGTGCTAGAATTATCAGGG + Intronic
951593343 3:24290382-24290404 CTGAAATGTCTGAATTAACACGG + Intronic
951962625 3:28346488-28346510 CTCAATTTCCCCATTTATCATGG - Intronic
954231765 3:49223369-49223391 CGAAATTCCCTGAGTTATCATGG + Intronic
955073852 3:55594349-55594371 CACAATTGCCTGAATGAACTGGG + Intronic
957101042 3:75829130-75829152 CTCTATTGCCTGCGTTATGAAGG + Intergenic
957269837 3:78015387-78015409 TTCAATTACCTCAATTATTAGGG + Intergenic
957673278 3:83333192-83333214 ATCAGTTGCATGGATTATCAAGG + Intergenic
957934824 3:86928838-86928860 CACAACTACCTGGATTATCAAGG - Intergenic
959424517 3:106169609-106169631 CTCAATTGCCTATATTTTAATGG + Intergenic
965225645 3:165985554-165985576 TTCTACTGCCTGAAATATCAGGG + Intergenic
1202747735 3_GL000221v1_random:123321-123343 CTCTATAGCCTGCATTATGAAGG + Intergenic
971168793 4:24212047-24212069 CTCACTTGCCTGCATACTCATGG + Intergenic
971957396 4:33439665-33439687 CTCCATTTCTTGAATTTTCATGG + Intergenic
972861112 4:43169837-43169859 GTCAATGGCCTCAAATATCAAGG + Intergenic
976584832 4:86784596-86784618 TTTAATTACCTGAATTATTAGGG - Intronic
976950597 4:90825495-90825517 CGCATGTTCCTGAATTATCATGG + Intronic
979044372 4:115843268-115843290 CACAATTTTCTGAAATATCAAGG + Intergenic
979975632 4:127192803-127192825 CTCAATTTCCTTATTGATCAAGG + Intergenic
980310504 4:131124014-131124036 CTTAAGTGCCTGTATTATGAGGG - Intergenic
980797667 4:137705788-137705810 CTTAACTGCATAAATTATCAAGG + Intergenic
985149921 4:186936342-186936364 CCCTATTGCCTCAAATATCAAGG - Intergenic
1202754057 4_GL000008v2_random:40097-40119 CTCTATAGCCTGCATTATGAAGG - Intergenic
986740719 5:10702985-10703007 CTCAAATGCCTGAAGAATCTGGG + Intronic
986767969 5:10945250-10945272 TTCATTTGCCCCAATTATCACGG + Intergenic
986942403 5:12970173-12970195 CTTAATTGCATGTATTATTAAGG + Intergenic
988691455 5:33576717-33576739 CTCACTTGGCTGAATGCTCAAGG + Exonic
991343258 5:65635417-65635439 CTGAATTGCCTGCATTACCTTGG + Intronic
992560888 5:77951749-77951771 GTTAATTGCTTGAATTATTAAGG - Intergenic
992722862 5:79577973-79577995 CTCCAATCCCTGAATTCTCAGGG + Intergenic
993718194 5:91296084-91296106 ATCAAATGCCTGCATTATAAGGG + Intergenic
994231218 5:97312230-97312252 CGAAATTCCCTGAGTTATCATGG + Intergenic
994474944 5:100255431-100255453 CTCAATTTCACTAATTATCAGGG + Intergenic
1001609432 5:172988252-172988274 GTCAAGTGCCTGTATTATCTGGG + Intronic
1005122001 6:22400386-22400408 CTTAATTGACTGCATTTTCATGG - Intergenic
1008429144 6:51394342-51394364 CCCATTTGCCTGGATTCTCAAGG - Intergenic
1008738111 6:54572115-54572137 CTCAATATCATTAATTATCAGGG - Intergenic
1010298449 6:74229410-74229432 ATCATTTACCTGATTTATCATGG - Intergenic
1010333722 6:74655865-74655887 CTCAAGTCCCTGAATTAAAATGG + Intergenic
1016966082 6:149719612-149719634 CTCAGCTCCCTGAATTATCTAGG - Intergenic
1017609906 6:156174344-156174366 CTCCAATCCCTGAATTCTCAGGG + Intergenic
1018277913 6:162153031-162153053 TTTAAATGCCTGAATTACCAGGG + Intronic
1020876189 7:13697604-13697626 CTCAAATTCCTCAATTAACAAGG - Intergenic
1021893330 7:25209327-25209349 CTCAATATCATTAATTATCATGG - Intergenic
1023088798 7:36598841-36598863 CTCAAATGCCTGAAGTATCTTGG - Intronic
1026531413 7:71200996-71201018 CTGAATTGCCTGAATTCTTTGGG - Intronic
1027161287 7:75804372-75804394 CTCCAATCCCTGAATTCTCAGGG - Intergenic
1027362413 7:77422830-77422852 CCCAAGTCCCTGAATTTTCAGGG + Intergenic
1032714831 7:134498724-134498746 CTCATTTGTCTGGATTTTCATGG + Intergenic
1038182335 8:25241068-25241090 CTCTCTTCCCTGAATTATCAGGG - Intronic
1038423236 8:27447465-27447487 CTCTATAGCCTGACTCATCAGGG + Intronic
1038492459 8:27980823-27980845 CTCAATTTCCTGGAGTATCTAGG + Intronic
1045341321 8:101257204-101257226 CCCATTTCCCTGAATTTTCAGGG - Intergenic
1046190397 8:110788233-110788255 CTCAATTCTCTGATTGATCAAGG - Intergenic
1046713626 8:117542850-117542872 ATCTAATGCCTGAATAATCAGGG - Intergenic
1047810225 8:128400639-128400661 CTCAGTTGCCTGAACCATCTTGG - Intergenic
1047842792 8:128772121-128772143 CTCAATATCACGAATTATCAGGG + Intergenic
1047993012 8:130306209-130306231 CTAGATTGCCTGCAGTATCAAGG - Intronic
1051854096 9:21542752-21542774 CTCTATTCCCTGATATATCAAGG - Intergenic
1053447393 9:38163651-38163673 CTCAACTGCCTGATTCAGCACGG - Intergenic
1056088560 9:83181605-83181627 CACAATTGACTGAATTTTCTTGG - Intergenic
1059978810 9:119746698-119746720 CTCAATTGCCTCACTTTTAAAGG + Intergenic
1203756987 Un_GL000218v1:140751-140773 CTCTATTGCCTGCATTATGAAGG + Intergenic
1203716369 Un_KI270742v1:153412-153434 CTCTATAGCCTGCATTATGAAGG + Intergenic
1203534845 Un_KI270743v1:24823-24845 CTCTATAGCCTGCATTATGAAGG - Intergenic
1203650600 Un_KI270751v1:116975-116997 CTCTATAGCCTGCATTATGAAGG + Intergenic
1190629543 X:52371680-52371702 CTCAATTTCCTGAATTCTCATGG + Intronic
1194475876 X:94359697-94359719 GTCTCTTGCCTGAATTATCATGG - Intergenic
1198025559 X:132702969-132702991 CTCAAATGCCTTTATTCTCATGG - Intronic
1198748418 X:139914185-139914207 CTCAATTCACTGAATAATCTTGG + Intronic
1198995941 X:142574264-142574286 CTCAATTTCCGTAATTATCAGGG + Intergenic
1200381443 X:155841698-155841720 CTCAGTTGCCTCTGTTATCATGG + Intergenic
1201170560 Y:11258367-11258389 CTCTATTGCCTGCATTATGAAGG + Intergenic