ID: 949262958

View in Genome Browser
Species Human (GRCh38)
Location 3:2123588-2123610
Sequence AGTTCAGAAACATGAGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949262958_949262960 28 Left 949262958 3:2123588-2123610 CCCTACTCTCATGTTTCTGAACT 0: 1
1: 0
2: 0
3: 14
4: 263
Right 949262960 3:2123639-2123661 GTAGTTTTCTAGCGCTACACTGG 0: 1
1: 0
2: 0
3: 2
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949262958 Original CRISPR AGTTCAGAAACATGAGAGTA GGG (reversed) Intronic
900839533 1:5037012-5037034 AATTAAGGAACATGAAAGTATGG + Intergenic
907482054 1:54751898-54751920 AGTTCAGAAATGAGACAGTAAGG + Intergenic
907511691 1:54966152-54966174 AGTTCTGACCAATGAGAGTAAGG + Intergenic
907847479 1:58222323-58222345 AGTTCTTAACCATGAGAGGATGG - Intronic
908121371 1:60989261-60989283 AGTTCAGGAACAAGTGAGGAGGG + Intronic
909177182 1:72376063-72376085 ATGTCAGAAACATGAGAGTTAGG - Intergenic
909238825 1:73185437-73185459 AGTTCAAAGACCTGAGAGCATGG - Intergenic
911112296 1:94202823-94202845 ATTTTAGAAAAATGAGAGCAAGG + Intronic
911612892 1:99976625-99976647 AGCTATGAAACATGAGACTATGG + Intronic
912044699 1:105439191-105439213 AATTTATAAATATGAGAGTAAGG + Intergenic
912617327 1:111116553-111116575 AGTTATGAAGCATGATAGTATGG - Intergenic
912674626 1:111667231-111667253 AGTGGAGAAACAGGAGAGGAGGG - Intronic
912859499 1:113200581-113200603 AGTCCAGAAGCCTGAGATTAAGG + Intergenic
914071399 1:144293376-144293398 AGTGGAGAAACTTGAGAGTTTGG - Intergenic
914919011 1:151835127-151835149 AGTACAGAAACATGGGAGTGAGG - Intergenic
915160131 1:153913452-153913474 AGGCTAGAAACAGGAGAGTAAGG - Intronic
916384678 1:164254180-164254202 ATTTCTGAGACATCAGAGTAGGG - Intergenic
920518831 1:206607710-206607732 AGGTCACAAACAGGAGACTAAGG + Intronic
920872986 1:209809433-209809455 AGTTGAGTGACATGAGAGTAGGG - Intergenic
923957124 1:239034741-239034763 AGTTCAAAGGCCTGAGAGTAAGG - Intergenic
1065820376 10:29519774-29519796 TGTTCAGAATCATGATAGAAAGG - Intronic
1066780501 10:38941481-38941503 AGTCTAGAAACAAGAGACTAGGG - Intergenic
1070950916 10:80429910-80429932 ACATCAGAAACATGCCAGTAGGG - Intronic
1071845554 10:89517940-89517962 ATTTCAGAAACATTAAAATAAGG + Intronic
1072229165 10:93398993-93399015 AGGTGAGAAACATGACAGGAAGG + Intronic
1072625998 10:97112346-97112368 AGCTCAGAACCATGGGAGGATGG - Intronic
1074433226 10:113411189-113411211 AGTTCCAAAACTTAAGAGTAGGG - Intergenic
1074914559 10:117942934-117942956 ACTTCATAAACATGAGATCAGGG + Intergenic
1076353104 10:129832154-129832176 AGTTCAGAAAGTTTAGAGGATGG - Intergenic
1079081495 11:17416385-17416407 AGTTAAGAAATATGACTGTAAGG - Intronic
1080077512 11:28168707-28168729 AATTCAGGTACATGAGAATATGG - Intronic
1080116529 11:28627636-28627658 AGTTCTGAAACAAGTGACTACGG - Intergenic
1080135690 11:28851566-28851588 AGTTCAGATACAAAAGAGAAGGG - Intergenic
1080331215 11:31141383-31141405 AGTTCAGAGCAATGAGAGTTTGG - Intronic
1080859152 11:36138197-36138219 AGTTAAGAAAGGTGAGAGTCAGG - Intronic
1081727792 11:45343765-45343787 TGTTCATAAAAATGAGAGAAAGG + Intergenic
1083383895 11:62293079-62293101 AGTTCAAAAACCTGAGAATGAGG - Intergenic
1086940873 11:92797128-92797150 TGTTCAGAAGCATGAGAGAGGGG + Intronic
1087229495 11:95644386-95644408 ATTTCTGAAACATGTCAGTATGG + Intergenic
1087867806 11:103253952-103253974 AGTTAGGAAACATGTGAGTATGG - Intronic
1089347206 11:117797921-117797943 ACTTCATAAAGATGAGTGTAAGG - Intronic
1090932590 11:131311700-131311722 ACTTCAGAAACACCAGAGGAGGG + Intergenic
1090942955 11:131404652-131404674 ATTTCAGAGACATGAAAATATGG - Intronic
1091523885 12:1276533-1276555 AGTTGAAAAACATGAGAGGCTGG - Intronic
1092601837 12:10075168-10075190 ATGTCAGAAACATGAAAATAGGG - Intronic
1092832132 12:12454589-12454611 ATTTCAGAAACATCTGAGAAGGG + Intronic
1093334453 12:17885423-17885445 AGTGCAGAAGCTTGAGAGTCAGG - Intergenic
1093725329 12:22500748-22500770 ATTTCAGAAACATTAAAATATGG - Intronic
1095469411 12:42520446-42520468 AGTTGAGGAAAATGAGATTAAGG - Intronic
1097396366 12:59079944-59079966 TGTTCAGTAACCTGAAAGTAGGG + Intergenic
1097571645 12:61340521-61340543 ATTTCAGAAACATCAGGGGAAGG - Intergenic
1100793528 12:98156115-98156137 AGTACAGAAAGAGGAAAGTAGGG + Intergenic
1101067511 12:101038217-101038239 AGTTCAGAAACACCTGCGTATGG - Intronic
1102590330 12:113951746-113951768 AATGCAGAAACATGACAGTGAGG + Intronic
1105222232 13:18342067-18342089 AGTGGAGAAACTTGAGAGTTTGG + Intergenic
1105911749 13:24874880-24874902 AGTTCAGAGACAGTAGACTATGG - Intronic
1107594231 13:41945380-41945402 AATTAAGAAATAGGAGAGTATGG + Intronic
1108289595 13:48945763-48945785 TGGTCTGAAACATGAGAGGAGGG + Intergenic
1108405177 13:50093677-50093699 AATTAAGAGACATGAGGGTAAGG + Intronic
1109071873 13:57779707-57779729 AATTCAGAAACTTGAAAGTTTGG - Intergenic
1113292634 13:108923298-108923320 AATTCAGACACAGGAGAGAAGGG + Intronic
1114908502 14:27162174-27162196 GGTTCAGGAAGATGAGAGAAAGG - Intergenic
1115501541 14:34054087-34054109 AGTTTAGACTAATGAGAGTAAGG - Intronic
1116307470 14:43276450-43276472 AGTTCTGAAACATGAAAAGAAGG + Intergenic
1117553939 14:56865199-56865221 AATTCAGAGACCTGAGATTATGG - Intergenic
1118253801 14:64187251-64187273 AATTCACAAAAATGAGATTAAGG - Intronic
1118610885 14:67538808-67538830 AGTTCAGAACCATGATGTTACGG + Intronic
1118953438 14:70457059-70457081 AGTAAAGAAACTTAAGAGTAGGG - Intronic
1120820476 14:88907430-88907452 AATACAGAAACAGGAGAATAGGG + Intergenic
1121284342 14:92723576-92723598 ACTTCAAAAACATGACACTAGGG + Intronic
1121858327 14:97291239-97291261 AGTCCAGAAACATGAGGATGTGG - Intergenic
1202936744 14_KI270725v1_random:94627-94649 AGTCTAGAAACAAGAGACTAGGG + Intergenic
1125178310 15:36851590-36851612 TCTTCAGAAACAAGAGAGCAAGG - Intergenic
1125490351 15:40142980-40143002 TTTTGAGAAACAGGAGAGTAAGG + Intergenic
1126693223 15:51304033-51304055 AGTTCAGAAAGATAAGACCAGGG + Intronic
1130142235 15:81237139-81237161 GGTTCATAAAGATGAGAGTGAGG - Intronic
1130361960 15:83197583-83197605 AGTTCAGAAACTTGAAGATAGGG - Intronic
1130534359 15:84772899-84772921 AGTTCAGTAACAGGACATTAAGG - Intronic
1133933015 16:10247702-10247724 ATTTCAGAAACAGGAAAATATGG - Intergenic
1134136276 16:11678307-11678329 AGTTCTGAAACGTGAGGGGATGG - Exonic
1136901916 16:34049809-34049831 AGTCTAGAAACAAGAGACTAGGG - Intergenic
1137778100 16:51073357-51073379 AGACCAGAAGCATGAGAGGATGG - Intergenic
1138912023 16:61412523-61412545 AGTTAAGACAGATGAGTGTAAGG - Intergenic
1139840946 16:69879418-69879440 AATGCAGAAACAGGAGAATAGGG - Intronic
1140815010 16:78613279-78613301 CTTTCAGAAACATGAGCGTATGG + Intronic
1142304255 16:89276714-89276736 AGTTCAGAAACAGCAGAGATAGG - Intronic
1145709820 17:26962157-26962179 AGTCTAGAAACAAGAGACTAAGG - Intergenic
1146143915 17:30393601-30393623 AGATCACAAAAATGTGAGTAAGG + Intronic
1146549305 17:33766109-33766131 AGTCCAAAAACAGGTGAGTATGG + Intronic
1148114201 17:45165415-45165437 AGTTCAGAGACATGTGAGCGTGG - Intronic
1149398198 17:56266426-56266448 AGTGGAGAAAGATGAGAATAGGG - Intronic
1151393302 17:73802274-73802296 ATTTCTGAATTATGAGAGTAGGG - Intergenic
1153409938 18:4782316-4782338 AGCTCAGAATCAGGAGGGTAGGG + Intergenic
1154518462 18:15198599-15198621 AGTCTAGAAACAAGAGACTAGGG + Intergenic
1157212460 18:45755371-45755393 AGAAGAGAAACATGAGAGAATGG - Intergenic
1157581287 18:48775666-48775688 AGTTTAGGAACATCAGAGGAAGG + Intronic
1158271851 18:55725074-55725096 AGTTGAGAATAAAGAGAGTAGGG - Intergenic
1159555279 18:69939236-69939258 AGTTCAGAAACATGGTAGGTGGG - Intronic
1164603738 19:29580906-29580928 ATTTCAGCAATCTGAGAGTATGG - Intergenic
1165455675 19:35909276-35909298 AGCTGAGAAAGGTGAGAGTAAGG + Intergenic
925228339 2:2206286-2206308 TGTTCAAAGACATGAAAGTATGG - Intronic
929406636 2:41649999-41650021 TGTTCAGGAACATGTGGGTATGG + Intergenic
929486443 2:42359643-42359665 AGTATAGAAACATGAGGGAAGGG - Intronic
931815513 2:65896856-65896878 ACATAAGGAACATGAGAGTAAGG + Intergenic
931934712 2:67184320-67184342 AGTAGAGAAACATGAGAGTCTGG + Intergenic
932081341 2:68718341-68718363 AGTTCAGAAAGATGGAAGAAAGG - Intronic
932135380 2:69224528-69224550 AGTTCTGAAACTTGGAAGTAGGG - Intronic
932548603 2:72742652-72742674 GGTTAAGAAACATGTTAGTATGG - Intronic
933760403 2:85668400-85668422 AGTCCAGGAACATGGGAGTCTGG - Intronic
933948443 2:87308387-87308409 AGTTCAGACACACCAGAGTAGGG + Intergenic
934304182 2:91808710-91808732 AGTCTAGAAACAAGAGACTAGGG - Intergenic
934329073 2:92044040-92044062 AGTCTAGAAACAAGAGACTAGGG + Intergenic
934467292 2:94273963-94273985 AGTCTAGAAACAAGAGACTAGGG + Intergenic
936331755 2:111553208-111553230 AGTTCAGACACACCAGAGTAGGG - Intergenic
937573295 2:123390376-123390398 AGTTAAGAAACAAGCAAGTAAGG + Intergenic
937635266 2:124148437-124148459 AGTTTAGAAACATGACGATACGG - Intronic
938315748 2:130326915-130326937 AGTTAACCAACATGAGAGGAAGG + Intergenic
938518441 2:132039098-132039120 AGTCTAGAAACAAGAGACTAGGG + Intergenic
938654947 2:133421775-133421797 TGTTCAGAAAGAGGAAAGTAAGG - Intronic
939196129 2:138974822-138974844 ACTCCTGAAACATGATAGTAAGG + Intergenic
939277416 2:140016666-140016688 AGTTAAAAAAAATGAGAGAAAGG + Intergenic
939466086 2:142559528-142559550 AGCTCAGAGACATGATAGAATGG - Intergenic
939611853 2:144320609-144320631 AATTCAGAACCAGGAGAGTTTGG - Intronic
939675602 2:145068470-145068492 GGAACAGAAACATGAGAATATGG + Intergenic
940043092 2:149380727-149380749 AGTTGAGAGACATGAGCATACGG + Intronic
940930258 2:159420512-159420534 GGTTTAGAACCATTAGAGTATGG - Intronic
941027969 2:160479323-160479345 AGGTTAGACACATGAGAGCAAGG + Intronic
941080206 2:161051791-161051813 AGTTAAGAATCTTGAGAGGAGGG - Intergenic
942033012 2:171981817-171981839 AATTCAGAAACATCAGAAAATGG + Intronic
942040416 2:172056248-172056270 AGCTCAGTAAAATGAGAGTTGGG - Intronic
942375273 2:175330251-175330273 AATTGAGAAAGATGAGAGAAAGG + Intergenic
942565321 2:177260541-177260563 AGTGCCAAAACATGAGATTAGGG + Intronic
943157061 2:184195534-184195556 ATGTCAGAAAAATGAGAGAAAGG - Intergenic
944255017 2:197616652-197616674 ATTTCAGAAACATGGGTCTAGGG + Intronic
944886996 2:204073023-204073045 ATTACAGAAACAGCAGAGTAGGG + Intergenic
946575989 2:221076192-221076214 TGTCCAGAAACTTGAAAGTAAGG - Intergenic
946892410 2:224291510-224291532 AGCTGGGAAACATGAGAGTGAGG - Intergenic
948188611 2:236041545-236041567 TGTTCATAATCTTGAGAGTAGGG + Intronic
948210070 2:236186302-236186324 AGAGCAGAAACAAGAGAGTGGGG - Intergenic
1169753192 20:9016155-9016177 AGTTCAGAATTGTGAGAGTGAGG - Intergenic
1169985792 20:11442648-11442670 AGTTCAGTAACATGATAAAATGG - Intergenic
1170095130 20:12637700-12637722 TTTTCAGAAGAATGAGAGTAAGG + Intergenic
1172640952 20:36440141-36440163 GGTTCAGAACCATGAGGATAAGG + Intronic
1173542609 20:43865853-43865875 ATTTCATAAACATCAGAGTGGGG - Intergenic
1174745342 20:53056794-53056816 AGTTCAGGCACATGAGAGAGAGG - Intronic
1175115805 20:56681169-56681191 TGTTCAGAAAGATGAGTGAAAGG - Intergenic
1176586569 21:8594349-8594371 AGTCTAGAAACAAGAGACTAGGG - Intergenic
1176730781 21:10494490-10494512 AGTGGAGAAACTTGAGAGTTTGG + Intergenic
1176743268 21:10627063-10627085 AGTCTAGAAACAAGAGACTAGGG - Intergenic
1176956688 21:15112991-15113013 TCTTGAGAATCATGAGAGTACGG - Intergenic
1180269377 22:10571254-10571276 AGTCTAGAAACAAGAGACTAGGG - Intergenic
1180534501 22:16386406-16386428 AGTCTAGAAACAAGAGACTAGGG - Intergenic
1183236763 22:36624561-36624583 AATTCAGAAACAGGAAAGAAAGG - Intronic
1203238303 22_KI270732v1_random:30005-30027 AGTCTAGAAACAAGAGACTAGGG - Intergenic
1203289349 22_KI270735v1_random:18380-18402 AGTCTAGAAACAAGAGACTAGGG + Intergenic
949262958 3:2123588-2123610 AGTTCAGAAACATGAGAGTAGGG - Intronic
950171010 3:10839125-10839147 ATTTCAGAAACAGGAGGGAATGG - Intronic
955483417 3:59412264-59412286 ATTACAGAGACATGAAAGTAAGG - Intergenic
956915390 3:73865669-73865691 AGTTCAGAAAGATCAAAGTTTGG - Intergenic
958456037 3:94332543-94332565 TGTTCAGGAACATGACAGCAAGG + Intergenic
958691336 3:97471502-97471524 AGCTCAGAAATATGAGTCTAAGG - Intronic
959517284 3:107283159-107283181 TGTTGAGTAACTTGAGAGTAAGG - Intergenic
961311165 3:126002994-126003016 AGTTCAAAGTCATGAGAATATGG - Intergenic
962442090 3:135429667-135429689 AGGTCAGGAGCATGAGAGTGAGG + Intergenic
963410418 3:144920887-144920909 ATCTCAGAAACATGAGAACAGGG + Intergenic
963765881 3:149335551-149335573 AGTTTAGGGACATGAGAGGAAGG + Intergenic
965105752 3:164350131-164350153 AGTTCAGAAACAAGTGATTCAGG - Intergenic
970185541 4:13447401-13447423 GGTTCAGAAATATGAAACTAAGG - Intronic
971169953 4:24223744-24223766 TGTACAGAAACATGAAAATATGG + Intergenic
971211549 4:24622545-24622567 AGTTCAGAAAGTTGGGAGCAAGG - Intergenic
971292865 4:25360495-25360517 CGTTCAGATTCATGAGAGCATGG + Intronic
972522506 4:39872943-39872965 AATTGAGAATCATGAGATTAAGG - Intronic
973093004 4:46161726-46161748 AGTTAAGAAACAAGAAAGAAAGG + Intergenic
973829683 4:54746125-54746147 ATTTCAGATAAATGAGAGTGTGG + Intergenic
975581806 4:75913604-75913626 AGTTCAGAACCATAAGACTTCGG + Intergenic
976449795 4:85175169-85175191 ATTTCAGAAACATAATACTATGG + Intergenic
976454910 4:85234960-85234982 TGATCAGTCACATGAGAGTAAGG - Intergenic
978642723 4:110890752-110890774 AGTTCAGAAAACTGATGGTATGG - Intergenic
979444582 4:120796156-120796178 AGTTGAGAAACATAGAAGTAAGG - Intronic
980380087 4:132002193-132002215 ATTTAAGTACCATGAGAGTAAGG - Intergenic
982364769 4:154565393-154565415 AATTCACAAAAATGAAAGTAGGG + Intronic
983016893 4:162624235-162624257 TCTTCAGAAAGATGAGACTAAGG - Intergenic
983847558 4:172538676-172538698 ACTTCAAATAGATGAGAGTAAGG + Intronic
984013849 4:174403063-174403085 AGATCAGTAACATGAGGGAATGG + Intergenic
986990983 5:13552859-13552881 AGTTCAGAAGCAAGAAAGAAAGG - Intergenic
987198158 5:15547959-15547981 ACTGCAGAAAGATGAGAGTGGGG + Intronic
987684591 5:21181135-21181157 AATACAGAAACATGAGAATAAGG - Intergenic
988231919 5:28490448-28490470 AGGGCAGAAATATGAGATTAAGG + Intergenic
988301617 5:29436881-29436903 CATTCAGAAACAAGAAAGTAGGG - Intergenic
990629301 5:57650776-57650798 AGGACAGAAACATGACAGGAAGG - Intergenic
991763131 5:69942766-69942788 CATTCAGAAACAAGAAAGTAGGG + Intergenic
991784195 5:70175363-70175385 CATTCAGAAACAAGAAAGTAGGG - Intergenic
991842358 5:70817806-70817828 CATTCAGAAACAAGAAAGTAGGG + Intergenic
991876642 5:71175747-71175769 CATTCAGAAACAAGAAAGTAGGG - Intergenic
992593433 5:78320527-78320549 AGTCAAGAAACATGAGACAATGG - Intergenic
995423517 5:111993108-111993130 TGTTCAGAAACTGGAGAGAAAGG + Intronic
995490642 5:112687926-112687948 ATATCATAAACATGAGATTATGG - Intergenic
995754941 5:115493010-115493032 AGTTCAGACATATGCAAGTATGG - Intergenic
995919910 5:117299228-117299250 AGGTCAGAAACAAGGCAGTAAGG + Intergenic
998209911 5:140187666-140187688 AGTTTAAAAACATAAGAGCAGGG - Intronic
998693018 5:144608377-144608399 AGATGAGAAACATGATAGTCAGG - Intergenic
998939471 5:147265467-147265489 ATTTTAGAAAGATGAGAGAATGG + Intronic
999364383 5:151012427-151012449 AGCTCAGTAACATGAGACAAAGG + Intergenic
1003091718 6:3109431-3109453 AGATCAGAGACAAGAGGGTAGGG + Intronic
1003950272 6:11109893-11109915 AGTTCAGGAAAAAGACAGTAGGG - Intronic
1004458863 6:15817080-15817102 GGTTCAGGTACATGAGAGGAGGG + Intergenic
1004962592 6:20807548-20807570 TGTTCAGAAACAGTAGAGAAGGG - Intronic
1005151385 6:22755632-22755654 TATTAAGAAACATCAGAGTAAGG - Intergenic
1005265304 6:24106184-24106206 ACTTCAGAAAGCTGAGTGTATGG - Intergenic
1005418920 6:25629387-25629409 AATGCAGAAACATGAAAGTCCGG + Intergenic
1006589776 6:35146014-35146036 AGTTCTGAAGGATGAGAGTCAGG - Intronic
1006901305 6:37503784-37503806 AGTGCAGAAACAAGAGAATGGGG + Intergenic
1007484676 6:42172775-42172797 CCTTCAGGAACATGAGAGTGTGG + Intronic
1008558552 6:52700249-52700271 AGTTAACAAATATGAGAATATGG + Intergenic
1009004882 6:57772772-57772794 CATTCAGAAACAAGAAAGTAGGG - Intergenic
1009650160 6:66465695-66465717 AGGTCAGAGACAAGAGAGCAGGG - Intergenic
1010018049 6:71127340-71127362 AGCACAGAGGCATGAGAGTATGG - Intergenic
1011542191 6:88442832-88442854 AGTTCAACAACAGGTGAGTAGGG - Intergenic
1011996970 6:93602713-93602735 GGTTCAAAAACAGGTGAGTACGG + Intergenic
1012345562 6:98180984-98181006 AGTTTAGAAACAAGAGAGGAAGG + Intergenic
1014323073 6:119956458-119956480 TGTTTTGAAACATGAGATTAAGG + Intergenic
1014467280 6:121771935-121771957 AGATAAGAAACAGGAGAGTAGGG - Intergenic
1014772035 6:125467723-125467745 AGCTCAGAATCATGAGTGAACGG - Intergenic
1016618198 6:146077421-146077443 AGTTCAGAAAAAGCAGTGTAAGG - Intronic
1016742625 6:147543966-147543988 AGTTAAGATACAAGAGATTATGG + Intronic
1018624774 6:165766195-165766217 TGATCAGAACCATGAGAATAGGG + Intronic
1019108394 6:169689679-169689701 ACTTCAGAAACATGTGGGAATGG + Intronic
1020392322 7:7671359-7671381 GGTTCAGAAAAAAGAGACTAAGG - Intronic
1020723262 7:11776201-11776223 AGATCTGAAACATGAAAGTTAGG + Intronic
1021122456 7:16812495-16812517 AGTTTAGAAAACTGAGATTAAGG + Intronic
1021742038 7:23696726-23696748 AGTGAAGAAAGGTGAGAGTAAGG + Intronic
1025307066 7:57869720-57869742 AGTCTAGAAACAAGAGACTAGGG + Intergenic
1025838647 7:65122747-65122769 AGTCTAGAAACAAGAGACTAGGG - Intergenic
1025878624 7:65510361-65510383 AGTCTAGAAACAAGAGACTAGGG + Intergenic
1025884425 7:65573235-65573257 AGTCTAGAAACAAGAGACTAGGG + Intergenic
1027527427 7:79287505-79287527 AGTGCTGAAGCATTAGAGTAAGG + Intronic
1030197839 7:106869493-106869515 AGTTCAGAAACTGGAGAGCTTGG + Exonic
1030416907 7:109256787-109256809 AGTTCACAAACACCGGAGTATGG - Intergenic
1030858328 7:114589825-114589847 AGTTGACAAACAAAAGAGTATGG - Intronic
1030889934 7:114986934-114986956 AGTTCAGAAAAAAGTGAGTTAGG + Intronic
1031328401 7:120431887-120431909 GTTTCAGAAACAGTAGAGTATGG - Intronic
1032756276 7:134893608-134893630 AGGTCAGAAACAGGAGGGTGAGG - Intronic
1033987286 7:147241679-147241701 AGTTCAGAAGCCTAAGAATAGGG - Intronic
1034003430 7:147442493-147442515 AGCTCAGCCACAGGAGAGTAGGG - Intronic
1034108608 7:148514345-148514367 AGTTTAGAAACCTCAGAGTAAGG - Intergenic
1034598803 7:152227036-152227058 AGCTGAGAAACTTGAGAGTTTGG - Intronic
1037281916 8:17250698-17250720 AGTTCACAATCATTAGAGAAAGG - Intronic
1041032663 8:53754184-53754206 AGTTCAGAAAGATGAGAGATAGG + Intronic
1041823225 8:62063173-62063195 AGTTCAGTCACAGGAGAATAGGG + Intergenic
1043808033 8:84698670-84698692 AGTCCAGAAAGAAGAAAGTAAGG + Intronic
1047027377 8:120838776-120838798 AGTTAATAAACATGAGAGGCTGG + Intergenic
1048562273 8:135553205-135553227 AGGTAAGAAATATGAGAGTCTGG - Intronic
1049965870 9:779171-779193 ATTTCAGAAACTTGAGAGGATGG + Intergenic
1050949260 9:11567144-11567166 AGTTCAGCCACATTAGAATATGG - Intergenic
1051100831 9:13519064-13519086 AGTTGAAAAAAATAAGAGTACGG + Intergenic
1053066177 9:35071199-35071221 AATTCAGAAACTTGAGAAAAAGG + Intronic
1053697713 9:40652063-40652085 AGTCTAGAAACAAGAGACTAGGG + Intergenic
1053943739 9:43280917-43280939 AGTCTAGAAACAAGAGACTAGGG + Intergenic
1054309004 9:63451471-63451493 AGTCTAGAAACAAGAGACTAGGG + Intergenic
1054440945 9:65259419-65259441 AGTCTAGAAACAAGAGACTAGGG + Intergenic
1054489332 9:65762067-65762089 AGTCTAGAAACAAGAGACTAGGG - Intergenic
1055859027 9:80726132-80726154 AGTTCAGATAAATTAGAATAAGG - Intergenic
1059926371 9:119213365-119213387 AGTTCAGAAAAATGAGTTTCAGG - Intronic
1060363599 9:122985312-122985334 AGCTCAGAAAGATGACAGTTAGG + Intronic
1060606535 9:124919704-124919726 AATTCTGAAAGATGAGGGTAGGG + Intronic
1202780092 9_KI270717v1_random:25463-25485 AGTCTAGAAACAAGAGACTAGGG + Intergenic
1203586857 Un_KI270747v1:10820-10842 AGTCTAGAAACAAGAGACTAGGG + Intergenic
1203616474 Un_KI270749v1:71859-71881 AGTCTAGAAACAAGAGACTAGGG - Intergenic
1186738156 X:12488261-12488283 AGTTTAAAAAAATGTGAGTAAGG + Intronic
1186948023 X:14591136-14591158 GGTTCAGACACAACAGAGTAAGG + Intronic
1187813922 X:23210442-23210464 AGTTGTGAAACTTGAGAATAAGG + Intergenic
1191148476 X:57194074-57194096 ATTTCAGAATCATTTGAGTAGGG + Intergenic
1191785870 X:64916794-64916816 AGTTCAGATCCAAGAGAGCAAGG + Exonic
1192784732 X:74324972-74324994 AGATCAGGAAACTGAGAGTAAGG - Intergenic
1196225932 X:113166449-113166471 AGTTAAGATGCATGAAAGTATGG - Intergenic
1196604196 X:117637441-117637463 AGTTCAGAGACATGTGATTCTGG - Intergenic
1196988917 X:121306140-121306162 ATTTCAGAAAGTTGAGAGTGTGG + Intergenic
1197609244 X:128620680-128620702 AGTTCTGAACAACGAGAGTAGGG + Intergenic