ID: 949262959

View in Genome Browser
Species Human (GRCh38)
Location 3:2123589-2123611
Sequence CAGTTCAGAAACATGAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949262959_949262960 27 Left 949262959 3:2123589-2123611 CCTACTCTCATGTTTCTGAACTG 0: 1
1: 0
2: 0
3: 12
4: 196
Right 949262960 3:2123639-2123661 GTAGTTTTCTAGCGCTACACTGG 0: 1
1: 0
2: 0
3: 2
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949262959 Original CRISPR CAGTTCAGAAACATGAGAGT AGG (reversed) Intronic
900077856 1:832590-832612 CAGGACAGAAACAGGAGAGCAGG - Intergenic
901024740 1:6273202-6273224 CAGAGCAGAAACATGAAAGGTGG + Intronic
903793154 1:25907986-25908008 CTGTTCAGAAAAATGACAGACGG - Intergenic
906314484 1:44777369-44777391 GAGTTCAGAAAGATCAGAGCAGG - Intronic
906589903 1:47015200-47015222 CAGTGCAGAACAGTGAGAGTAGG + Intergenic
906951039 1:50334647-50334669 CAGTACAGAAATCTCAGAGTAGG + Intergenic
907032640 1:51187529-51187551 CAGTTATAAAACATCAGAGTTGG + Intergenic
908268309 1:62399529-62399551 CAGTTAAAAAATGTGAGAGTTGG - Intergenic
911969589 1:104414981-104415003 GAGGTCAGAAACTTGAGATTGGG + Intergenic
912940292 1:114038935-114038957 CAGTTCAGGAAGATGAGATGGGG - Intergenic
916156049 1:161849643-161849665 CAGTTCCAAACCTTGAGAGTTGG - Intronic
918956192 1:191211085-191211107 AAGTTTGGAAACATGAAAGTTGG + Intergenic
920872987 1:209809434-209809456 CAGTTGAGTGACATGAGAGTAGG - Intergenic
921422416 1:214963777-214963799 TGGTTCAGAAAGATGAGAATGGG + Intergenic
921959697 1:221021905-221021927 CATGTCAGAAACAAGAGATTAGG + Intergenic
924166676 1:241290763-241290785 CAGTTGAGAAAATTGAGATTTGG - Intronic
924183509 1:241463516-241463538 CAGTTAAGAGACATGTGAATGGG + Intergenic
1063409861 10:5828985-5829007 CAGCACAGAAACACGAGGGTGGG - Intronic
1063748189 10:8910991-8911013 CTGTCCAGAAACTTAAGAGTTGG + Intergenic
1064047292 10:12028966-12028988 CACTACAGAGACATGAGTGTGGG + Exonic
1064303713 10:14146355-14146377 GAGTTCAGAAACATTAAAATAGG + Intronic
1064828182 10:19429842-19429864 AAGCTCAGAAGCCTGAGAGTAGG - Intronic
1065398475 10:25267809-25267831 CTTTTCAAAAACATGTGAGTAGG + Intronic
1069657308 10:70099520-70099542 CATCTCAGAGACATGAGAGCTGG + Intronic
1071227399 10:83546460-83546482 CATTACAGAAACATAAAAGTTGG - Intergenic
1071739721 10:88343445-88343467 AAGTTCAGAATAATGAAAGTAGG + Intronic
1074433227 10:113411190-113411212 CAGTTCCAAAACTTAAGAGTAGG - Intergenic
1075008238 10:118845796-118845818 CAGTTGAGAAAATTGAGACTTGG + Intergenic
1078765537 11:14293471-14293493 CAGTTAAAAAAGATGAGATTTGG - Intronic
1080880503 11:36315832-36315854 CAGTTCACACAGATGAGTGTAGG + Intronic
1085022833 11:73219800-73219822 CAGTTGAGGAAGGTGAGAGTAGG - Intronic
1086940872 11:92797127-92797149 GTGTTCAGAAGCATGAGAGAGGG + Intronic
1087399861 11:97651764-97651786 CAGTTAGGAGACATGAGAATGGG + Intergenic
1093349692 12:18082821-18082843 CATTTCTTAAACAGGAGAGTTGG - Intronic
1093410329 12:18857664-18857686 GAGTTCAGAAAAGTGTGAGTTGG - Intergenic
1096398586 12:51286672-51286694 CAGTGCAGAAAAATGAGAAGTGG + Intronic
1098196930 12:68012098-68012120 CAGGAAAGAAACATCAGAGTAGG - Intergenic
1102019932 12:109675366-109675388 CAGGTCAGAAATAACAGAGTTGG + Intergenic
1102767948 12:115449888-115449910 CAGGTCAGAGACATGAGTGATGG - Intergenic
1102848295 12:116211908-116211930 CTGTAAAGCAACATGAGAGTAGG + Intronic
1107593812 13:41939504-41939526 CACATCATAGACATGAGAGTTGG - Intronic
1108289594 13:48945762-48945784 CTGGTCTGAAACATGAGAGGAGG + Intergenic
1113520330 13:110936096-110936118 CCCTTCATAAACTTGAGAGTGGG + Intergenic
1115053243 14:29090869-29090891 CAGCTCTGCAACATGAGAGCAGG - Intergenic
1115082578 14:29474760-29474782 CATTTCAGAAATATGGGAGTGGG - Intergenic
1116456910 14:45130574-45130596 CAGTTCAGAAAAATTACAGGTGG + Intronic
1119854535 14:77889507-77889529 CAGATCATAGACATGGGAGTGGG + Intronic
1121033384 14:90678729-90678751 CAATTAAGAAGCAGGAGAGTTGG + Intronic
1121989844 14:98545873-98545895 CAGTGCAAAAACATGAGCTTTGG + Intergenic
1122674473 14:103399769-103399791 CAGTTCAGTAATATTGGAGTTGG + Intronic
1124131010 15:26985648-26985670 CAGCTCAGAAAAATGCAAGTGGG - Intronic
1125608270 15:40954444-40954466 TAGTTCAGTAGCATGAGAATGGG + Intronic
1126698979 15:51350879-51350901 TAGTTCTGGGACATGAGAGTAGG - Intronic
1127419141 15:58788028-58788050 CACTTCAGAAAGGTGAGACTGGG - Intronic
1129148563 15:73671859-73671881 TAGTTCAGAAACGTGAGTGGTGG + Intergenic
1135198619 16:20417295-20417317 CAGTTCATAGACATTAGGGTTGG - Intronic
1138366714 16:56484777-56484799 CTGTTCAAAATCATGCGAGTGGG - Exonic
1140653353 16:77112983-77113005 CAGGTCATAAACATGTGATTTGG - Intergenic
1141934088 16:87225265-87225287 AAGTTCAGACACATCAGAGTTGG - Intronic
1144268343 17:13593451-13593473 TGGTTCGGAAACAAGAGAGTAGG + Intronic
1145727325 17:27142960-27142982 CAGTTCAGAAACATGTGCAAAGG - Intergenic
1148526886 17:48347215-48347237 CATTTCACAAACATGAAAATAGG + Intronic
1148952202 17:51323088-51323110 GAATTCACAAACATGAAAGTTGG - Intergenic
1154080974 18:11256523-11256545 CAGTTCTGAAAAATGAGGTTTGG + Intergenic
1155345953 18:24856853-24856875 CATTTAAAAATCATGAGAGTTGG + Intergenic
1155431779 18:25767031-25767053 CAGTTGAGATACATGATTGTTGG - Intergenic
1156490759 18:37494651-37494673 CAGCTCAGAAGCTTGAGACTGGG + Intronic
1158271852 18:55725075-55725097 CAGTTGAGAATAAAGAGAGTAGG - Intergenic
1159555280 18:69939237-69939259 AAGTTCAGAAACATGGTAGGTGG - Intronic
1163878173 19:19893655-19893677 CTGTTCAGTAAGATGTGAGTAGG - Exonic
1164409823 19:27992530-27992552 CATTACAGAAGCATGAGGGTAGG - Intergenic
1166890580 19:45989926-45989948 CAGATCAAAAACCTTAGAGTTGG + Intergenic
925901834 2:8514330-8514352 CAGTTAAGAGACAGCAGAGTGGG - Intergenic
926991420 2:18684834-18684856 CAGTACAGAATCATGAAACTGGG + Intergenic
928253621 2:29702997-29703019 CAGTTTAGAAAACTGAGGGTGGG + Intronic
929858657 2:45656334-45656356 CACTTCGGAAACATTGGAGTAGG + Intronic
931829686 2:66037971-66037993 CAGTTCAGAATGACGAGACTGGG - Intergenic
932734271 2:74243347-74243369 CAGTTCAGGAAGAAGAGAGAGGG - Intronic
933514336 2:83281465-83281487 GAGTTCAGAAATATCAGAGATGG - Intergenic
933948442 2:87308386-87308408 TAGTTCAGACACACCAGAGTAGG + Intergenic
935136335 2:100306277-100306299 CACTACTGAAACATGAAAGTTGG - Intronic
936331756 2:111553209-111553231 TAGTTCAGACACACCAGAGTAGG - Intergenic
936553017 2:113466761-113466783 CAGTTTAGAAACTGGAGATTTGG + Intronic
937835363 2:126465940-126465962 CAGGACAGAAATAGGAGAGTGGG + Intergenic
939393593 2:141600595-141600617 AAAGTCAGAAACATGAGGGTTGG - Intronic
940646557 2:156398427-156398449 CAGAGCAGCAACAAGAGAGTGGG + Intergenic
941616077 2:167721342-167721364 CAGTGCAGAAAAGGGAGAGTTGG + Intergenic
942040417 2:172056249-172056271 AAGCTCAGTAAAATGAGAGTTGG - Intronic
942944217 2:181656287-181656309 CAAGTCAGCAAAATGAGAGTTGG + Intronic
943245150 2:185437725-185437747 CACTTCAGAATCAAGAGATTAGG + Intergenic
944255016 2:197616651-197616673 CATTTCAGAAACATGGGTCTAGG + Intronic
944866956 2:203871804-203871826 CAGCCCTGAAACATGAGATTAGG + Intronic
945605518 2:211925100-211925122 CAGTTCAGAAATACTATAGTTGG + Intronic
948210071 2:236186303-236186325 AAGAGCAGAAACAAGAGAGTGGG - Intergenic
1170867711 20:20174822-20174844 CAGTTCGGAAATGTGAGAGTGGG + Intronic
1171979864 20:31620091-31620113 GAATTCAGAAAAATGAGACTTGG - Intergenic
1173542610 20:43865854-43865876 TATTTCATAAACATCAGAGTGGG - Intergenic
1178154586 21:29836588-29836610 AAGTTTATAAACATGAAAGTTGG + Intronic
1179941910 21:44645758-44645780 CAGTCCAGAAACAGGATAGGTGG + Intronic
1180261200 21:46670353-46670375 CAGTTCAAAAAGATGATTGTGGG - Intergenic
949186013 3:1192229-1192251 CACTTCAGAAAAGTGAGAATTGG - Intronic
949262959 3:2123589-2123611 CAGTTCAGAAACATGAGAGTAGG - Intronic
949587766 3:5459388-5459410 CAGTTGGGATACCTGAGAGTTGG + Intergenic
950900068 3:16489606-16489628 AATTTCTGAAACATGAGAGCAGG + Intronic
951054629 3:18133412-18133434 GAGTTCAGAAATATGAGAGAAGG + Intronic
951099079 3:18665874-18665896 AAGTACAGAAACATGTGAATGGG + Intergenic
951997603 3:28748510-28748532 CATTTCAGAAGAATGAGAGCTGG + Intergenic
952696140 3:36266999-36267021 TTGTTCAGAAACAGGAGAGATGG - Intergenic
953490124 3:43342671-43342693 CAGGTCAGCTACAAGAGAGTGGG + Intronic
954284576 3:49609776-49609798 TGGTACAGAGACATGAGAGTAGG - Intronic
956973149 3:74550367-74550389 GTGATCAGAAACATGGGAGTGGG + Intergenic
959393762 3:105809858-105809880 CACTTCAGAAACATGATAATGGG - Intronic
960412293 3:117342363-117342385 CAGATCAGACACAAGAGAGAAGG - Intergenic
961470158 3:127106347-127106369 CAGTTTAGAAACAAAAGACTAGG + Intergenic
962900099 3:139754442-139754464 CAGCTGAGGAATATGAGAGTGGG - Intergenic
963513450 3:146278146-146278168 CAGGCCAGGAACATAAGAGTTGG - Intergenic
964536923 3:157732281-157732303 CAGTTCATAAACATCATAATTGG + Intergenic
970397060 4:15679431-15679453 CAATTCAAAAACAAGAGACTTGG - Intronic
970501524 4:16681904-16681926 CAGTTCTGCAACTTGAGAGCTGG + Intronic
971342915 4:25787135-25787157 CAGGTCAGAAACATACCAGTTGG + Intronic
971718479 4:30213410-30213432 CAGTTGAGAAAAGTGAGACTGGG - Intergenic
972002658 4:34058449-34058471 CAGTGCAGAAACATAATATTGGG - Intergenic
975182967 4:71368432-71368454 CCCTTCAGAAACATAAGACTGGG - Intronic
975537288 4:75464434-75464456 CAGATCATAACCATGAGAGTTGG - Intergenic
977314732 4:95431436-95431458 AACTTCAGAAACACTAGAGTGGG + Intronic
979882270 4:125975990-125976012 CAGACCAGAAACATGAAAGCTGG - Intergenic
980780995 4:137492028-137492050 CAGCTCTCAAACATGTGAGTGGG + Intergenic
982364768 4:154565392-154565414 CAATTCACAAAAATGAAAGTAGG + Intronic
983887399 4:172995769-172995791 CATGTCAGAAACATGAAAGCAGG - Intronic
984603785 4:181760343-181760365 CAGTTTAAAAACAATAGAGTGGG - Intergenic
984861069 4:184239249-184239271 CATTTCACAAACGTGAGGGTTGG + Intergenic
987198157 5:15547958-15547980 CACTGCAGAAAGATGAGAGTGGG + Intronic
988951831 5:36270314-36270336 CACTTCAGAATCTTGAGAATAGG - Intronic
989959839 5:50399419-50399441 TAGTTCATCAACATTAGAGTAGG - Intronic
990722654 5:58714472-58714494 CACTTCAAAAACATGAAAGGAGG + Intronic
993133628 5:83929751-83929773 CAGTCCAGAATCATGGGAGTTGG + Intergenic
994041629 5:95265451-95265473 CAGTTCTCAAACCTGAGAGGTGG - Intronic
995504028 5:112840174-112840196 CAGTTCAGGAAAATGACAATGGG + Exonic
997170886 5:131718806-131718828 TAGTTGAGAAACATGAGATGTGG - Intronic
997525167 5:134548365-134548387 CAGTTGAGAAACCTGGGACTCGG - Intronic
997707120 5:135966304-135966326 CAGTTGAAAAACATGAGCCTAGG - Intergenic
998706135 5:144763540-144763562 CATTTGAGAAATAGGAGAGTTGG + Intergenic
999848526 5:155512192-155512214 CAGTTAACAAACATGAGATGTGG + Intergenic
1002961692 6:1921289-1921311 TAGTTTAGAAACATGAGACTGGG - Intronic
1004063077 6:12217322-12217344 CAGTTCAGAATAATAAGAATTGG - Intergenic
1006901304 6:37503783-37503805 GAGTGCAGAAACAAGAGAATGGG + Intergenic
1008056658 6:46952580-46952602 CATTTCAGAAAGAAGAGTGTGGG + Intronic
1010557868 6:77307162-77307184 AACTTCACAAACATGAGAGGGGG - Intergenic
1012694678 6:102363814-102363836 CATTTAAGAAACATGAAAATTGG - Intergenic
1013278331 6:108608610-108608632 CTGTTCAGAAACCATAGAGTTGG - Intronic
1013443443 6:110195465-110195487 CAGGTCAAGAACATGAGATTTGG + Intronic
1014467281 6:121771936-121771958 TAGATAAGAAACAGGAGAGTAGG - Intergenic
1015189759 6:130459852-130459874 CAGTTCTGAAACAGTGGAGTTGG + Intergenic
1015468758 6:133578049-133578071 TAGAACAGAAACATGAGAGATGG + Intergenic
1016677133 6:146783944-146783966 CTCTTCATAAAAATGAGAGTAGG - Intronic
1016785240 6:148004103-148004125 CAGATTAGAATCATGAGAGATGG - Intergenic
1016825665 6:148386405-148386427 CAGTTCACAAACGTGAAAGCTGG + Intronic
1017095484 6:150800978-150801000 CAGTTGTGAAATATGAGTGTGGG - Intronic
1018602900 6:165564241-165564263 GAGTCAAGAAACATGAGAGCTGG + Intronic
1018632028 6:165829691-165829713 GAGTTCGGAAACTTGAGAGTAGG - Intronic
1021253321 7:18358807-18358829 CAGTTCAGAAATATCAGTGAGGG - Intronic
1021812783 7:24419524-24419546 GAGTTCAGAGACATGAAAATGGG + Intergenic
1024371498 7:48589322-48589344 CATTTTAGAAACATCAGGGTTGG + Intronic
1026439778 7:70434016-70434038 CAGTACAAAAACAACAGAGTGGG - Intronic
1031192616 7:118573772-118573794 AATTTCAAAAACATGAGAATTGG - Intergenic
1033046557 7:137967654-137967676 CAGTTCAGAGACATGGGGCTTGG - Intronic
1033667363 7:143454461-143454483 GACTTCAGAAACATGAGATAGGG - Intergenic
1034003431 7:147442494-147442516 CAGCTCAGCCACAGGAGAGTAGG - Intronic
1034323366 7:150206004-150206026 CATTTCAGAACACTGAGAGTTGG + Intergenic
1034487735 7:151376533-151376555 GAGCTCTTAAACATGAGAGTCGG + Intronic
1034769832 7:153763185-153763207 CATTTCAGAACACTGAGAGTTGG - Intergenic
1035093735 7:156334941-156334963 GAGTCCAGAAACATGGGAGAAGG + Intergenic
1035195632 7:157218105-157218127 CATTTCAGAATCTTGGGAGTAGG + Intronic
1035527767 8:327047-327069 CAGGACAGAAACAGGAGAGCAGG + Intergenic
1037572513 8:20170577-20170599 CAGTTAATAAATATCAGAGTTGG - Intronic
1038389227 8:27179655-27179677 CAGATGAGAAACAGGAGATTGGG + Intergenic
1039456624 8:37711549-37711571 CGCTTCAGAAACACGAGAGAGGG - Intergenic
1041823224 8:62063172-62063194 CAGTTCAGTCACAGGAGAATAGG + Intergenic
1043969399 8:86513643-86513665 CAATTGAGTAACATGAGATTTGG - Intronic
1045419033 8:101995714-101995736 CATTTCCCAAACATGAGATTTGG + Intronic
1046686083 8:117228315-117228337 CATTTTAGAAATATGAGAGCCGG + Intergenic
1047097751 8:121642025-121642047 CAGCTCAGAAACTTTTGAGTTGG - Intergenic
1048450222 8:134527003-134527025 CAGTTCAGGATCTTGAGAGGGGG + Intronic
1048697922 8:137049399-137049421 CAGTGCAGAAGCATAAGAATGGG - Intergenic
1049013252 8:139902195-139902217 CAGATCTGGAACATGAGAGCGGG - Intronic
1049899983 9:150425-150447 CAGTTTAGAAACTGGAGATTTGG - Intronic
1050115591 9:2259954-2259976 CACTTCAGAATCCAGAGAGTAGG - Intergenic
1050330652 9:4541979-4542001 CAGTTTAGAAACAGCAGATTCGG - Intronic
1050905538 9:11000007-11000029 CAGTTGAGAGACATCAAAGTTGG + Intergenic
1051388259 9:16535125-16535147 CAGTTCAGAGAAATGAAACTAGG + Intronic
1053743033 9:41160721-41160743 CAGTTTAGAAACTGGAGATTTGG - Intronic
1054348309 9:63990534-63990556 CAGTTTAGAAACTGGAGATTTGG - Intergenic
1054446036 9:65316903-65316925 CAGTTTAGAAACTGGAGATTTGG - Intergenic
1054484235 9:65704609-65704631 CAGTTTAGAAACTGGAGATTTGG + Intronic
1054685310 9:68270580-68270602 CAGTTTAGAAACTGGAGATTTGG + Intronic
1055163503 9:73161535-73161557 CAGCTCAGGGAAATGAGAGTAGG - Intronic
1055260767 9:74430340-74430362 AAGTTCAAAAACAAAAGAGTTGG - Intergenic
1056195259 9:84222581-84222603 ATGTGCAGAAACATGAGAGATGG + Intergenic
1060606534 9:124919703-124919725 CAATTCTGAAAGATGAGGGTAGG + Intronic
1062123649 9:134847968-134847990 CGGTGCAGACCCATGAGAGTGGG + Intergenic
1189113394 X:38317759-38317781 CTGTTTAGAAACATCAGAATGGG - Intronic
1193239572 X:79151583-79151605 CACTTGAGAATCAAGAGAGTTGG + Intergenic
1194776742 X:97974383-97974405 CAGTTCAGAAGCATCAGGCTTGG + Intergenic
1196110575 X:111942625-111942647 TAGCACAGATACATGAGAGTAGG + Intronic
1196686851 X:118517925-118517947 CAGTTCAGAAAATTCAGAGTAGG - Intronic
1197051049 X:122060341-122060363 CTCTTCAGAAATATTAGAGTAGG - Intergenic
1197099610 X:122636947-122636969 CAGTTCAGCCACATTAGAATAGG - Intergenic
1197508917 X:127346571-127346593 CAGTTCAGACACAGCAGGGTAGG - Intergenic
1197609243 X:128620679-128620701 CAGTTCTGAACAACGAGAGTAGG + Intergenic