ID: 949262960

View in Genome Browser
Species Human (GRCh38)
Location 3:2123639-2123661
Sequence GTAGTTTTCTAGCGCTACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 19}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949262958_949262960 28 Left 949262958 3:2123588-2123610 CCCTACTCTCATGTTTCTGAACT 0: 1
1: 0
2: 0
3: 14
4: 263
Right 949262960 3:2123639-2123661 GTAGTTTTCTAGCGCTACACTGG 0: 1
1: 0
2: 0
3: 2
4: 19
949262959_949262960 27 Left 949262959 3:2123589-2123611 CCTACTCTCATGTTTCTGAACTG 0: 1
1: 0
2: 0
3: 12
4: 196
Right 949262960 3:2123639-2123661 GTAGTTTTCTAGCGCTACACTGG 0: 1
1: 0
2: 0
3: 2
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949262960 Original CRISPR GTAGTTTTCTAGCGCTACAC TGG Intronic
913517701 1:119618462-119618484 GTAGTTTTCTGCTGCTAGACTGG - Intergenic
922140492 1:222880716-222880738 GTAGTCTTCTCTCGCCACACAGG - Intronic
1123962839 15:25424194-25424216 TTACTTTTCTAAAGCTACACTGG + Intronic
1150029173 17:61713483-61713505 GTAGTATCCTAGGCCTACACAGG - Intronic
1153504977 18:5787736-5787758 GGACTTTTCCAGCACTACACAGG + Intergenic
1158665032 18:59424625-59424647 TTAGTTTTGTAGGGCTACGCAGG + Intergenic
932298478 2:70646131-70646153 TTAGTTTTCTAGCCCTACAAGGG + Intronic
934119071 2:88822993-88823015 GTAGATTTCAAGCACAACACTGG + Intergenic
934151487 2:89151777-89151799 TTATGTTTCTAGTGCTACACAGG - Intergenic
934215772 2:90030129-90030151 TTATGTTTCTAGTGCTACACAGG + Intergenic
934847547 2:97671946-97671968 GTAGTTTTCTAACCCTCCAGGGG + Intergenic
1175496034 20:59414964-59414986 GTAGCTTTCTAGCGATCCAATGG - Intergenic
1178992826 21:37368306-37368328 GAAGTTTTGTGGCGATACACAGG - Intronic
949262960 3:2123639-2123661 GTAGTTTTCTAGCGCTACACTGG + Intronic
972864028 4:43208186-43208208 GAAATTTTCTAGTGATACACTGG + Intergenic
999754652 5:154655332-154655354 GGAGATTTGTAGCCCTACACTGG - Intergenic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1002453696 5:179333404-179333426 GTACTTTTCAAAAGCTACACAGG - Intronic
1004162499 6:13227313-13227335 CTAGTTTTCTAAAGCTACACAGG - Intronic
1030660583 7:112214647-112214669 AAAGTTTTCTAGAGCTAAACAGG + Intronic
1042391315 8:68238991-68239013 GGAGTTTTCTAGCCTGACACTGG + Intergenic
1196495035 X:116314718-116314740 GTAGTTTTAAAGAGCTCCACAGG - Intergenic