ID: 949264823

View in Genome Browser
Species Human (GRCh38)
Location 3:2144498-2144520
Sequence TTGGCTGGACACACAGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949264823 Original CRISPR TTGGCTGGACACACAGATCA AGG Intronic
902878383 1:19354634-19354656 TTGGCAGGAGACACTGCTCACGG + Intronic
902983733 1:20142944-20142966 TTGGCTGTACACACTTCTCAAGG - Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906835620 1:49080532-49080554 TTGGCTGAAATCACAGGTCAAGG + Intronic
912547585 1:110462012-110462034 TGGGCTAGACTCACAGGTCAAGG - Intergenic
912868796 1:113284355-113284377 TTTGCTGGAAACACAGAAAAGGG + Intergenic
916468074 1:165092390-165092412 TTCGCTGGAGCCACAGATGAGGG - Intergenic
917600713 1:176571037-176571059 TTGGAGGGGCACACAGATGATGG - Intronic
918107337 1:181426117-181426139 TTGGCTGGACACACCCAGCTTGG + Intronic
918357686 1:183721105-183721127 TTGGTTGGAAACAGAGATCTGGG - Intronic
921730189 1:218569521-218569543 TTGCCTGAACCCACAGATCTTGG + Intergenic
1062998551 10:1891876-1891898 TTCACTGGAATCACAGATCAGGG - Intergenic
1067048386 10:42998663-42998685 CTGGCTGGATCCACAGCTCAGGG - Intergenic
1068388701 10:56364006-56364028 TTTGCTGGAAACAGAAATCAAGG - Intergenic
1069892723 10:71662041-71662063 TCTGCTGGTCTCACAGATCATGG + Intronic
1072290550 10:93960992-93961014 GTCGCTGGACACATAGAACAGGG + Intergenic
1072452477 10:95549530-95549552 TTGGCTTGACACAGAATTCAGGG + Intronic
1072479537 10:95797350-95797372 TGGGCTGGAAATACAGATCAGGG + Intronic
1072716698 10:97757136-97757158 TTGGCTGGACACAGTGAGCCAGG - Intronic
1073343595 10:102764820-102764842 CTGGCTGGAAGCACAGCTCATGG - Intronic
1073463839 10:103682224-103682246 TGGCCTGGACACACAGAGCAAGG - Intronic
1074307017 10:112288393-112288415 TGGGCTGGACAGACAGATAACGG + Intronic
1074364693 10:112848555-112848577 CAGGCTGGAGACACAGATCATGG + Intergenic
1077275418 11:1704413-1704435 AGGGGTAGACACACAGATCAAGG + Intergenic
1079076155 11:17386622-17386644 CTGGCTGGACGCACAGCTCTAGG + Exonic
1080168955 11:29275688-29275710 ATCACTGGACACACAGATCTGGG + Intergenic
1080643213 11:34170013-34170035 TTGGAAGGCCACACAGAGCATGG - Intronic
1083731734 11:64655970-64655992 CTGGCTGGACAGAGAGAGCAGGG + Intronic
1083863100 11:65436325-65436347 TTGCTTTGACACACAGATGATGG - Intergenic
1086156640 11:83673928-83673950 TTGTCTGGAAAGACAGGTCAGGG - Intronic
1087496316 11:98894409-98894431 TAGGCTGCACACACAGCACAGGG + Intergenic
1090353269 11:126121492-126121514 TTGGCTGGATATGCAGATCTGGG + Intergenic
1091074564 11:132603156-132603178 TAGGCTGGACATACAGATTTAGG - Intronic
1096590595 12:52656505-52656527 TTGTGTGGCTACACAGATCATGG - Intergenic
1101183522 12:102248237-102248259 TTGGCTGGATATAGAAATCATGG + Intergenic
1104733098 12:131119813-131119835 ATGGCTGCACACCCAGAGCACGG - Intronic
1105364254 13:19750239-19750261 TTGGCTGTCCCCAGAGATCAAGG - Intronic
1110433008 13:75447690-75447712 GTGGCTGTACATACAGATAAAGG - Intronic
1113576948 13:111401887-111401909 TGGGGTGGACACACAGGTCGGGG - Intergenic
1117992922 14:61452364-61452386 TTGGAAGCACACACAGATCCAGG - Intronic
1118207942 14:63740642-63740664 TAGTCTGAACACACAGAGCATGG - Intergenic
1119870961 14:78016690-78016712 TTGGCTAAACTCACACATCAGGG - Intergenic
1120894404 14:89516948-89516970 TTTTCTGGACAGACAGGTCAAGG - Intronic
1122133285 14:99618563-99618585 GTGGCTGTACGCACAGTTCAGGG - Intergenic
1126229537 15:46308983-46309005 TTGGCTGGAAGCATAGTTCAGGG - Intergenic
1126405982 15:48323036-48323058 TTGACTGCAAACAAAGATCAAGG + Intergenic
1127691796 15:61403892-61403914 TTGGGTGGACAGACAGAGGAAGG - Intergenic
1128115382 15:65102034-65102056 TGGGCTGGACACCCAGATTATGG + Intronic
1129054958 15:72812689-72812711 CTGCCTGGAAACACAGAGCATGG - Intergenic
1132851872 16:2028460-2028482 AGGACTGGACACACAGACCATGG + Intronic
1134837710 16:17376019-17376041 GTGGTTGGATACACAGGTCAGGG - Intronic
1135170569 16:20179778-20179800 TGGGCTGGGCACACATCTCATGG - Intergenic
1140848192 16:78909651-78909673 TGGGATGGACACAGAGGTCAGGG - Intronic
1140940045 16:79712997-79713019 TTGGCTGTAACCTCAGATCAGGG - Intergenic
1141289118 16:82701305-82701327 TTGGATGGAAAAAGAGATCATGG - Intronic
1143656952 17:8300534-8300556 AAGGCTAGACACACAGATCAAGG - Intergenic
1144671264 17:17133932-17133954 CTGGCTGGAAACACAGCTCTGGG - Intronic
1146353037 17:32111843-32111865 GTCGCTGGATACACAGATGAGGG + Intergenic
1146757935 17:35449390-35449412 TTGGCTGGACCCTCAGAGGAGGG - Intergenic
1149936344 17:60810756-60810778 TCAGCTGGAGACAGAGATCAAGG + Intronic
1150265557 17:63830405-63830427 TGGACTGGACAAACAGATCAAGG + Exonic
1151589385 17:75033644-75033666 TTGCCTGGACACCCGGACCATGG - Intronic
1153000283 18:448954-448976 TTGGCTAGATACACAAAACAAGG + Intronic
1153970085 18:10218094-10218116 TGGTCTGGAAACACAGATGAAGG - Intergenic
1158001814 18:52628492-52628514 ATGGCTGTACACACAGATGAAGG - Intronic
1161253280 19:3292944-3292966 TCAGCTGGAGACACAGATCCTGG + Intronic
1161726850 19:5934187-5934209 TTGCCAAGACACACAGATGAAGG - Intronic
1162688475 19:12408706-12408728 TTTTCTGGACATACATATCAAGG - Intronic
1163629822 19:18412570-18412592 TTGCCTGGGGACACAAATCAGGG - Intergenic
1164417552 19:28059327-28059349 TTGGCTGGCCCCAAAGATCATGG + Intergenic
1164570440 19:29370979-29371001 TGGCCGGGAGACACAGATCATGG + Intergenic
1164667454 19:30050977-30050999 GTGGATGAACACCCAGATCAGGG - Intergenic
1167857543 19:52254865-52254887 CTGGCCGGATACACTGATCAGGG - Intergenic
1168705903 19:58470160-58470182 TTTGCTGAACACAAAGATGAAGG - Intronic
926090797 2:10047976-10047998 TTTGCAGGACACACACCTCACGG + Exonic
926448337 2:12972119-12972141 TTGGAAGCACACACAGAACATGG + Intergenic
927380147 2:22470108-22470130 TTGGCTGGAGTCATAGATGATGG - Intergenic
927441380 2:23120373-23120395 TTTGCTGGACACAGCAATCAGGG - Intergenic
928483708 2:31708570-31708592 TTGGACTGCCACACAGATCATGG - Intergenic
929907393 2:46058241-46058263 TTGGCAGGACACAAACATCCAGG + Intronic
930006745 2:46903962-46903984 TAGGCTGCACACACATGTCAGGG - Exonic
930698861 2:54439395-54439417 TTGGCTGCACAGACAGGTCAGGG + Intergenic
930920471 2:56747312-56747334 TTAGCTAGACAAACAAATCATGG - Intergenic
931675463 2:64691361-64691383 TTGGCTGAATACTCAGAACAAGG + Intronic
933482404 2:82874581-82874603 TTGGCTGGACACAAAATTCTTGG + Intergenic
934790175 2:97052845-97052867 TTGGCAGAACAATCAGATCACGG - Intergenic
934816295 2:97329692-97329714 TTGGCAGAACAATCAGATCACGG + Intergenic
934821401 2:97378792-97378814 TTGGCAGAACAATCAGATCACGG - Intergenic
934938672 2:98483789-98483811 TTGGCTAGCCACACAGAAGAGGG - Intronic
936348206 2:111691260-111691282 TTGAATGGACAGACAGATGAAGG + Intergenic
936377484 2:111954309-111954331 TTCACTTGACACACAGATCACGG + Intronic
937869115 2:126775206-126775228 TTGGATGGATACCCAGAACAAGG - Intergenic
939135309 2:138286645-138286667 TTAGATGAACACACAGATAAAGG + Intergenic
939224986 2:139353697-139353719 TAGGCTGCACACACACAGCACGG - Intergenic
943018049 2:182538172-182538194 TAGGCTGGATAAACAGACCAAGG - Intergenic
946640156 2:221775325-221775347 TGGGCTGGATTCACAGAGCAGGG - Intergenic
947562359 2:231167676-231167698 TTTAGTGGACACACAAATCAGGG + Intronic
948176291 2:235946047-235946069 CTGGGTGGAGACACAGATCCAGG + Intronic
948984563 2:241512526-241512548 TGGGGTGGCCACACAGCTCAGGG - Intergenic
1170745362 20:19093923-19093945 CTGGCTGGCCACACAGAGGACGG + Intergenic
1172333106 20:34090014-34090036 TTAGCTGGGCACCCAGACCAGGG + Intronic
1174121831 20:48271570-48271592 TTGGGTGGGGACACAGATCAGGG + Intergenic
1174858780 20:54070583-54070605 CTGGCTGAATACACAGAGCAGGG + Exonic
1177625100 21:23649001-23649023 TTGGGTGGTCTCACAAATCAAGG + Intergenic
1178667641 21:34562981-34563003 TTTGTTTGACACACAGAACAGGG + Intronic
1180589100 22:16921101-16921123 TTGGCAGAACAATCAGATCATGG - Intergenic
1182145346 22:27993813-27993835 GTGTCTGAACACACAGGTCAGGG + Intronic
1182832387 22:33314351-33314373 GTGGCGGGACTCACAGAGCAAGG + Intronic
1182848004 22:33447347-33447369 AGGGCTGGAGACACAAATCATGG + Intronic
1182983580 22:34695877-34695899 TTGGCTGAAGGCACAGAACAGGG - Intergenic
1183936042 22:41262968-41262990 TTGGTTAGACACCCAGACCATGG + Intronic
1185419152 22:50725779-50725801 GGGGCTGGAGACACAGCTCAGGG - Intergenic
949264823 3:2144498-2144520 TTGGCTGGACACACAGATCAAGG + Intronic
950617684 3:14175126-14175148 TTGGCTGGACACAGCGAGCGAGG - Intronic
950884253 3:16348854-16348876 GTGGCAGGACACAGAGATGATGG - Intronic
951373630 3:21886146-21886168 TTGGCAGCACACACTGATCCTGG + Intronic
954618416 3:51982427-51982449 TTGGCTGCTCACACATAACATGG - Intronic
957354822 3:79068218-79068240 TTTGCTGAACACATAGATTAAGG + Intronic
961498819 3:127315888-127315910 TTGAAGGGACACACAGATCCAGG - Intergenic
963231031 3:142909064-142909086 TTGGCTGGGCACACAACTCCTGG - Intergenic
965387106 3:168057656-168057678 TTGGGTGGGGACACAGAGCAAGG + Intronic
968623621 4:1615810-1615832 TTGGCTGCATCCACAGATGAAGG + Intergenic
968793155 4:2683094-2683116 TTGGCTGGACACATAATTCTAGG + Intronic
971225175 4:24745350-24745372 TTGGATGGACACACACACCCAGG + Intergenic
972429181 4:38964209-38964231 TTAGCAGGACACAGAGGTCAAGG + Intergenic
973250139 4:48051549-48051571 TTGGCTGGATATGCACATCAGGG + Intergenic
975173745 4:71262837-71262859 TTGGCTAGATACACAAAACAAGG - Intronic
976244478 4:82993525-82993547 TAAGATGGAAACACAGATCAGGG + Intronic
978813797 4:112879854-112879876 CTGGCTGGAGACACAGAAGAAGG - Intronic
981441087 4:144782754-144782776 TTGGCAGGAAACACAGCTCTTGG + Intergenic
985709111 5:1418217-1418239 TGAGCTGCACACACAGATCAGGG - Intronic
988596635 5:32599146-32599168 TTGGCAGGACACACGGGGCAAGG + Intronic
989118224 5:37977490-37977512 CTGGCTGCACACACACATCCTGG - Intergenic
993091399 5:83430931-83430953 TTGGCTAGACAGACAGAAAAAGG + Intergenic
993112619 5:83677490-83677512 TTGGCTGGACATCCAGTCCATGG - Intronic
993241902 5:85399675-85399697 TTCACTGGACACACAGTTCTTGG - Intergenic
995182384 5:109240972-109240994 TTGACTGTACAAACAGATGAGGG + Intergenic
996715519 5:126584739-126584761 TTGACAGGACACACAGATGCAGG + Intronic
997052828 5:130402901-130402923 TTGGCTGGATTCTCACATCATGG - Intergenic
997722781 5:136093345-136093367 TTGGCTGGACATACAATTCTTGG + Intergenic
997917228 5:137939603-137939625 TTCGCTGGTCACACAGCTCCCGG - Exonic
998904084 5:146885279-146885301 TGGGCTGTAGAGACAGATCATGG - Intronic
1000505529 5:162112730-162112752 TTTGCTGGGCATACAGATTAGGG + Intronic
1003011814 6:2433878-2433900 TTGGCTGGACACCAAGCTCCTGG - Intergenic
1003653811 6:7987039-7987061 GTCGCTGGACACATAGAACAGGG - Intronic
1003692174 6:8365598-8365620 TTTTGTGGACAGACAGATCAGGG + Intergenic
1005261321 6:24063912-24063934 ATGGCTGGGCACACAGATGAAGG + Intergenic
1007168769 6:39847611-39847633 GGGGCTGGACACACAGAGCAAGG - Intronic
1007449594 6:41932791-41932813 ATGGCTGAAGACCCAGATCAGGG + Exonic
1011480114 6:87785484-87785506 TTTGCTGGGCACAGAGATTAAGG - Intergenic
1020608732 7:10368620-10368642 TTAGCTGGACACAAAGTTCCAGG - Intergenic
1021556319 7:21922376-21922398 TAGGCTGAACACATATATCAGGG + Intronic
1023062762 7:36343957-36343979 TTGCCTGGAGACACGGTTCAGGG + Intronic
1023824081 7:43997157-43997179 TTGGCCAGACACAGAGAGCAAGG - Intergenic
1024281946 7:47725547-47725569 TTGGCTGGGCACTCAGCTCATGG + Intronic
1024348041 7:48333604-48333626 TAGGCTTAACACACAGATCTTGG + Intronic
1026375120 7:69742330-69742352 TTAGCTGGATACACAGTTCTAGG + Intronic
1026510990 7:71027279-71027301 ATGGCTGGGAACACAGAGCAGGG + Intergenic
1027328015 7:77063283-77063305 TTGGCCAGACACAGAGAGCAAGG + Intergenic
1027733084 7:81901059-81901081 TTGGCTGGACACAAAATTCTTGG + Intergenic
1029402937 7:100356812-100356834 CCAGCTGGACATACAGATCAGGG + Exonic
1029752346 7:102550482-102550504 TTGGCCAGACACAGAGAGCAAGG - Intronic
1029770298 7:102649576-102649598 TTGGCCAGACACAGAGAGCAAGG - Intronic
1031743998 7:125470025-125470047 TGTACTGGACACACAGTTCAAGG + Intergenic
1034724039 7:153318737-153318759 TTGGCTGCACCCCCAGGTCATGG + Intergenic
1035375843 7:158406224-158406246 TTGGCTGCACACTGAGATCCCGG + Intronic
1035375849 7:158406266-158406288 TTGGCTGCACACTGAGATCCCGG + Intronic
1035375855 7:158406308-158406330 TTGGCTGCACACTGAGATCCCGG + Intronic
1037048795 8:14342940-14342962 TAGGCTGCACACACAGCCCAGGG - Intronic
1037922555 8:22817636-22817658 TTGGCTGGTAACAGATATCAAGG - Exonic
1038322945 8:26545868-26545890 TTGTCAAGACAAACAGATCAAGG - Intronic
1038418969 8:27419999-27420021 CTGGCTGCACCCACAGATGACGG + Exonic
1038651369 8:29406833-29406855 TTGGAAGGAGACAAAGATCATGG + Intergenic
1039569307 8:38574401-38574423 TTGGCTGGACACAGAGGTTGAGG + Intergenic
1039579045 8:38649067-38649089 TTGGCTGGGCAACCATATCAAGG + Intergenic
1044687698 8:94843653-94843675 TTGGCTGTATACACATATGATGG + Intronic
1048451557 8:134538038-134538060 CAGGCTGCAAACACAGATCAGGG + Intronic
1048515191 8:135101822-135101844 TTGGATGTACACCCAGAACAGGG + Intergenic
1048621184 8:136134450-136134472 TTGGCTGAACACAATAATCACGG - Intergenic
1048738637 8:137530382-137530404 TTGGGTGGGGACACAGATCCAGG - Intergenic
1048910948 8:139134402-139134424 GGTGCTGGGCACACAGATCAGGG + Intergenic
1052790741 9:32873427-32873449 TTGGCTGCACACACTGATGTGGG - Intergenic
1055933896 9:81587564-81587586 GTGGCTGGACAAACAGATCAGGG - Intronic
1058636631 9:107044493-107044515 TTGGCTCAATACACAGATTAAGG - Intergenic
1058736647 9:107900008-107900030 TTGGCTGGATAGAAAGATGAGGG - Intergenic
1059658566 9:116378836-116378858 TTGTCTTGTGACACAGATCAGGG - Intronic
1059802478 9:117764153-117764175 TTGGGAGGACACAAAGAACAGGG - Intergenic
1060756825 9:126219763-126219785 GTGGCTGGACACCGAGAGCAGGG - Intergenic
1062386748 9:136315245-136315267 CTTTCTGGACACACAGTTCATGG - Intergenic
1185519871 X:730230-730252 TTAGCTGGACACAAAAATCCCGG - Intergenic
1189381459 X:40505434-40505456 TTGGCTGGAGCCCCAGGTCATGG + Intergenic
1192325092 X:70124991-70125013 TTGGCTGGATACAGTGATCGAGG + Intergenic
1193008457 X:76647513-76647535 TTGGGTGGAGACACAGATTTAGG - Intergenic
1193366477 X:80639591-80639613 TTGGCTGGACACACAATTCTTGG - Intergenic
1197302145 X:124794269-124794291 TTGGCTGGATACACAAACCTAGG - Intronic
1199644778 X:149896972-149896994 TTGGCTTTACATACAGAGCAGGG - Intergenic
1199653606 X:149972609-149972631 TAGGCTGGAAATACAGGTCAAGG + Intergenic