ID: 949271504

View in Genome Browser
Species Human (GRCh38)
Location 3:2223196-2223218
Sequence TTGTCCACCTAGAACAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949271504_949271508 21 Left 949271504 3:2223196-2223218 CCTTTACTGTTCTAGGTGGACAA 0: 1
1: 0
2: 0
3: 11
4: 100
Right 949271508 3:2223240-2223262 GTTCCGTCCAGTTGCCCTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 67
949271504_949271511 30 Left 949271504 3:2223196-2223218 CCTTTACTGTTCTAGGTGGACAA 0: 1
1: 0
2: 0
3: 11
4: 100
Right 949271511 3:2223249-2223271 AGTTGCCCTGTGGGTGTCCGTGG 0: 1
1: 0
2: 1
3: 11
4: 119
949271504_949271507 20 Left 949271504 3:2223196-2223218 CCTTTACTGTTCTAGGTGGACAA 0: 1
1: 0
2: 0
3: 11
4: 100
Right 949271507 3:2223239-2223261 TGTTCCGTCCAGTTGCCCTGTGG 0: 1
1: 0
2: 1
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949271504 Original CRISPR TTGTCCACCTAGAACAGTAA AGG (reversed) Intronic
901899820 1:12351053-12351075 TTGTCCACAAAGAACACTATAGG + Intronic
904606375 1:31700108-31700130 TTGTGCACCTAGAAGAGAAGGGG + Exonic
906045539 1:42827892-42827914 TTTTACACTTAGAACAGGAAAGG - Intronic
910430229 1:87152661-87152683 TTAACCACATAGAACAGTTAGGG + Intronic
910605699 1:89081450-89081472 TTGTTCTACAAGAACAGTAAAGG - Intergenic
919458246 1:197845791-197845813 GTGTCATTCTAGAACAGTAAGGG - Intergenic
924121732 1:240806835-240806857 CTTACCACCTAGAACAGAAAAGG - Intronic
1065083567 10:22151518-22151540 TTGTCCACCCAGAATACAAAAGG - Intergenic
1068187562 10:53605724-53605746 GTGTCCACCAAGAATAGAAAAGG - Intergenic
1074968456 10:118515380-118515402 TCTAGCACCTAGAACAGTAAGGG - Intergenic
1091152718 11:133343680-133343702 CTGTCTACCTAGCACTGTAATGG + Intronic
1092146398 12:6217701-6217723 TTGTCCTCCTGGAAAAGCAATGG - Intronic
1096551111 12:52372247-52372269 TTGTTCACCTAGAAAAGTGCTGG + Intergenic
1100645313 12:96523087-96523109 ATATCCATCTAGAACAGTCAGGG - Intronic
1108205777 13:48088198-48088220 TTCTCTACTTAGCACAGTAAAGG - Intronic
1108334376 13:49423839-49423861 TTGTAGACCTAGAAAAGTTAAGG + Intronic
1112326010 13:98443298-98443320 GTGACCACCTAGTACAGTCAGGG + Intronic
1119731341 14:76953305-76953327 TTATCCACCTAGAAAACTTAGGG - Intergenic
1121893561 14:97622593-97622615 TTGTCCACTTACTACATTAAGGG - Intergenic
1125259837 15:37810638-37810660 TTGTACAACTTGAAGAGTAAAGG + Intergenic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1128977675 15:72165438-72165460 TTGTCCATCTGGAACAGGCAAGG + Intronic
1129083152 15:73059635-73059657 TTTTCTACCTACAGCAGTAATGG - Intronic
1129556910 15:76519939-76519961 ATGTCCATCAAGAACATTAAGGG - Intronic
1130168221 15:81484923-81484945 TTGTACACCTTGGACAGTCAAGG - Intergenic
1130410384 15:83642986-83643008 TGCCCCACCTAGAACACTAAGGG - Intergenic
1130446301 15:84004972-84004994 TTCTCCTCCAAGAACAGGAAAGG + Intronic
1131808236 15:96145664-96145686 TGTTCCACCTTGAACAGTGAAGG - Intergenic
1135849915 16:25953854-25953876 TTGTCCACCTTGAAAGGTGAGGG + Intronic
1140607309 16:76554932-76554954 TTGAGCACCTAGAAGAGAAATGG - Intronic
1140897019 16:79333544-79333566 TTGTCCACCTAGCAAAATCATGG - Intergenic
1142822305 17:2479879-2479901 TTCTCCACCTATAAAAGTAAAGG + Intronic
1143294269 17:5859075-5859097 TTGTCCAACTTGAACAGTTTGGG + Intronic
1144037560 17:11381219-11381241 TGGACCACCTATAAGAGTAAGGG - Intronic
1144277815 17:13691228-13691250 ATGTTCACCTAGAAAAGTATAGG - Intergenic
1144514827 17:15910069-15910091 TTTTACACTTAGAACAGCAAGGG - Intergenic
1151005065 17:70425915-70425937 TTTTCCACCTTGAACATTCATGG - Intergenic
1162897709 19:13775232-13775254 TTGTAAACCTAGAACAGCAGAGG + Intronic
925272551 2:2623161-2623183 CTGTCCACCTCCAGCAGTAAAGG + Intergenic
925532143 2:4875886-4875908 TTGTCCAGCTGGTAGAGTAATGG - Intergenic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
928081925 2:28319512-28319534 TTGTCCAGCTAGAACCCTGAGGG - Intronic
928377194 2:30785028-30785050 TTTTCCAAGTAGGACAGTAAAGG - Intronic
929897109 2:45970539-45970561 TTATGTATCTAGAACAGTAAAGG + Intronic
932098487 2:68874074-68874096 TTGTCCACCCAGCACAGGTATGG - Intergenic
933372059 2:81427093-81427115 TTTTCTACCTAGGAAAGTAATGG - Intergenic
946356541 2:219189435-219189457 TATTCCCTCTAGAACAGTAATGG - Intergenic
946461277 2:219870972-219870994 TTGACCCCTTGGAACAGTAACGG - Intergenic
947286289 2:228519030-228519052 TTGTCCATCTAGAGAAGTAAGGG - Intergenic
1172259519 20:33550540-33550562 CTGTCCTCAGAGAACAGTAATGG + Intronic
1174949739 20:55030646-55030668 TTTTCCACAAAGAACAGAAAAGG - Intergenic
1183413010 22:37666295-37666317 TGGTCCACCCAGGACAATAAGGG - Exonic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
949271504 3:2223196-2223218 TTGTCCACCTAGAACAGTAAAGG - Intronic
949548603 3:5093739-5093761 TTGCCAACCTGGAATAGTAACGG - Intergenic
953314393 3:41912733-41912755 TTGTATATTTAGAACAGTAATGG + Intronic
954314972 3:49796050-49796072 TGGTGCACCCAGAACAGAAAAGG + Intronic
955254955 3:57321635-57321657 TTATCCACCCAGAAGAGTAAAGG - Intronic
956327559 3:68070441-68070463 TTGTCCACCTAGGCCAGTGATGG + Intronic
967725748 3:192860995-192861017 GTGTCCACCTAAACCAGGAATGG - Intronic
969555139 4:7902834-7902856 TTGTACAGATAGAAAAGTAAAGG - Intronic
973801063 4:54479170-54479192 TTCTCTACCTAGGACAGGAAAGG - Intergenic
975417583 4:74122760-74122782 TTATCCACCCATAACGGTAAAGG + Intronic
976004621 4:80414465-80414487 TTGTTCACTTAGAACATCAAAGG + Intronic
976976587 4:91172720-91172742 TTTTCCTCCTAGAAGAGTAGTGG + Intronic
981788798 4:148511718-148511740 TTGCATACCTAGTACAGTAATGG + Intergenic
982149449 4:152436593-152436615 CTGTCCAGCTAGAAGAGTCATGG - Intronic
987624371 5:20378453-20378475 ATGTCCACCTAGACCAGTGCTGG - Intronic
988935793 5:36081816-36081838 CTGCCCACCCAGAACATTAAGGG + Intergenic
989743938 5:44805792-44805814 TTCTGCACCTAGAACAGTATTGG + Intergenic
989814199 5:45716049-45716071 TTTTTCACCTAGAAGAGAAAGGG - Intergenic
994441713 5:99814631-99814653 TTGACCAACTGGAACAGAAATGG + Intergenic
1000038561 5:157467577-157467599 TTTTCCACCTAAAAGAGTCAGGG - Intronic
1000195416 5:158952431-158952453 TTGTCCTCCTGGTACAGTGATGG + Intronic
1003031923 6:2608793-2608815 CTGTACCCCTAGCACAGTAAAGG - Intergenic
1004786368 6:18972455-18972477 TTGTCCACCTTCAACTGAAATGG - Intergenic
1012969305 6:105710450-105710472 TAGTTCACCTAAAACACTAAGGG + Intergenic
1013918870 6:115375669-115375691 TCATCCACCCAGAACAGTAATGG - Intergenic
1015874408 6:137808600-137808622 TTTTACACGAAGAACAGTAATGG - Intergenic
1016744481 6:147563551-147563573 TTGTCCATCTAGATCTGTCAAGG + Intronic
1025734192 7:64132437-64132459 TTGATCACCTAGAGCAGGAATGG + Intronic
1026558476 7:71428416-71428438 ATGTCCACCAAGAAAAGCAATGG - Intronic
1027725397 7:81799172-81799194 TAGTGCACTTAGAACAGGAATGG - Intergenic
1028491532 7:91417783-91417805 TTGTCCACATCCAACTGTAAGGG - Intergenic
1028933127 7:96436518-96436540 TAGTCTACCTTGAACACTAATGG - Intergenic
1028939378 7:96503846-96503868 TTCTTCAGCTAGAAGAGTAAGGG + Intronic
1031247703 7:119337730-119337752 CTATCCAGCTAAAACAGTAAGGG - Intergenic
1031742511 7:125452683-125452705 GTATCCTCCTAGAACAGTGAAGG + Intergenic
1034730651 7:153384808-153384830 TTCTACACCTAGAACAGTGCCGG - Intergenic
1039745287 8:40420126-40420148 TGGTCCACCTAGAACAGTCCTGG + Intergenic
1050044598 9:1529739-1529761 TTGACCACCTGCAATAGTAAAGG + Intergenic
1052399418 9:27981684-27981706 TTGTCCATCTAGATTAGTGAAGG + Intronic
1053162339 9:35821893-35821915 TTGTCCACCCACAACAGGAAGGG - Intronic
1053373442 9:37583197-37583219 TTGTCCACTTAAAACAATATTGG - Intronic
1053571526 9:39314069-39314091 TTGTCCACTTTGGAAAGTAATGG + Intergenic
1053837438 9:42155422-42155444 TTGTCCACTTTGGAAAGTAATGG + Intergenic
1054093085 9:60872771-60872793 TTGTCCACTTTGGAAAGTAATGG + Intergenic
1054114563 9:61148683-61148705 TTGTCCACTTTGGAAAGTAATGG + Intergenic
1054125619 9:61304943-61304965 TTGTCCACTTTGGAAAGTAATGG - Intergenic
1054593191 9:67033844-67033866 TTGTCCACTTTGGAAAGTAATGG - Intergenic
1058462196 9:105193255-105193277 TTGTTAACCTACAACAGGAAAGG + Intergenic
1185937685 X:4277295-4277317 TTCTCCAGCTAGAACACTAGAGG + Intergenic
1186927634 X:14352704-14352726 TTGTCCACATGTAACAGTAAAGG - Intergenic
1186941259 X:14510178-14510200 TTTTAGACCTAGGACAGTAACGG - Intergenic
1188107681 X:26163711-26163733 TTATCCACCCAGAACAGCAGGGG + Intergenic
1188111070 X:26196940-26196962 TTATCCACCCAGAACAGTAGGGG + Intergenic
1188482313 X:30648494-30648516 TTGTCAAACTAGAAAATTAAAGG + Intergenic
1190775671 X:53550587-53550609 TTCTCCACCTATAAAACTAAGGG + Intronic
1192362952 X:70450624-70450646 TTGTTCACCTAGAAGAGGAGAGG - Exonic
1194509493 X:94775604-94775626 TAGTCCACCTACAACAGCATAGG - Intergenic
1196284876 X:113867836-113867858 TTTACCACCCAGTACAGTAATGG + Intergenic
1197361273 X:125505880-125505902 TTGCCCACCTATAAAAATAAAGG - Intergenic