ID: 949275388

View in Genome Browser
Species Human (GRCh38)
Location 3:2273994-2274016
Sequence AACAACCCATGTTGGATCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949275388 Original CRISPR AACAACCCATGTTGGATCTT AGG Intronic
905336870 1:37250698-37250720 AACAAACCATCCTGGCTCTTAGG - Intergenic
913029251 1:114882058-114882080 AAAAACCCGTGTTGCATCTTGGG + Intronic
916599862 1:166282337-166282359 CAGAACCCATGTTTGATGTTGGG + Intergenic
921418028 1:214913246-214913268 AATAAAGCATGTTGGATGTTAGG - Intergenic
922535270 1:226375145-226375167 AACAACGCAAGTTAGCTCTTGGG - Intronic
923210228 1:231797313-231797335 AACAACCCATTTTTGATATTTGG - Intronic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1064976202 10:21118851-21118873 AACACCCAATGTTGTATTTTGGG - Intronic
1065841210 10:29703001-29703023 AAGAATGCATCTTGGATCTTAGG + Intronic
1069044020 10:63723734-63723756 AAAAACCCATTTTGGAGCTCTGG - Intergenic
1070429475 10:76322717-76322739 TAAAACTCATGTTGGATTTTTGG + Intronic
1074273012 10:111973306-111973328 AACCACCAATGTTGGATTATTGG - Intergenic
1079598335 11:22281551-22281573 TGCAACCAATGTAGGATCTTTGG + Exonic
1080029556 11:27646500-27646522 AACAATCCATGTTGACTGTTTGG - Intergenic
1085128068 11:74015429-74015451 AAACAGCCATCTTGGATCTTGGG - Intronic
1091124749 11:133083771-133083793 CACAGCCCATGTGGGATCCTGGG - Intronic
1091580076 12:1780767-1780789 AGCAACCCAGTTTGGCTCTTAGG + Intronic
1092861147 12:12719841-12719863 ACCAACCCATGTTGGTTATCTGG - Intronic
1093035453 12:14328351-14328373 AACAATCCAGGTAGGCTCTTTGG - Intergenic
1104528676 12:129548533-129548555 AAAATCCCATATTGGATATTAGG + Intronic
1110812822 13:79829298-79829320 AACAGCCCATGCTGGCTGTTGGG - Intergenic
1111724465 13:91988181-91988203 AAAAAGCAATGTTTGATCTTGGG - Intronic
1115069251 14:29301449-29301471 AACAACCCACATTGGGTCCTTGG - Intergenic
1116278644 14:42871527-42871549 AACACCGCATGTTGGTTTTTTGG + Intergenic
1118441921 14:65820478-65820500 CTCAACCCTTGTTGGATGTTTGG + Intergenic
1120701257 14:87701707-87701729 AACTAACCAAGTAGGATCTTTGG - Intergenic
1125006669 15:34824553-34824575 AAGAACCCGTATTGGATCTGGGG - Intergenic
1125121761 15:36168363-36168385 AGCAATCCATTTTGAATCTTGGG - Intergenic
1128022561 15:64404987-64405009 CCTAACCCATTTTGGATCTTGGG + Intronic
1135576657 16:23591199-23591221 AACATCACATGTTGGCTGTTGGG - Intronic
1140703462 16:77604066-77604088 GACAACCAAAGTTTGATCTTTGG + Intergenic
1150610599 17:66730281-66730303 AAGAACCCATGTGGCCTCTTAGG - Intronic
1155528676 18:26743639-26743661 AAGAAACTCTGTTGGATCTTTGG + Intergenic
1158337136 18:56425269-56425291 AATTACCCATGTTGGGTGTTGGG - Intergenic
1167137690 19:47627106-47627128 AGCAACCCAGGCTGGCTCTTGGG - Intronic
928000426 2:27518870-27518892 AAAACCACATGTTGGACCTTCGG + Exonic
929020350 2:37546779-37546801 AACAGCCCAAGTTGTACCTTGGG + Intergenic
933063204 2:77764474-77764496 AACAACACATGTTGGAGAGTGGG - Intergenic
935275635 2:101473816-101473838 AACATCCCATCCTGGATCTAGGG + Intronic
939826546 2:147022719-147022741 AAGAACCTATGTTGAATATTGGG - Intergenic
941191331 2:162386744-162386766 AATAAACCATTTTGTATCTTTGG + Intronic
941749422 2:169119379-169119401 AACCAAGCATGTTGGATCTTTGG - Intergenic
944650320 2:201823284-201823306 AATAACTCATGTTGTATTTTTGG + Intronic
946410043 2:219511251-219511273 AACCCCCCAGGTTGGATCCTGGG + Intergenic
1170537873 20:17359293-17359315 AATTACCCATATTGGATTTTCGG - Intronic
949275388 3:2273994-2274016 AACAACCCATGTTGGATCTTAGG + Intronic
950861397 3:16150527-16150549 CACAGCCCATGTTGAATCTCTGG + Intergenic
953036671 3:39217583-39217605 AACATCCCCTTTTGGATCATAGG + Intergenic
958504999 3:94965292-94965314 AACATCCCATGTTGTTTGTTGGG - Intergenic
962475457 3:135751458-135751480 AACAACCCATGCTTGATCCCTGG - Intergenic
967816906 3:193807209-193807231 AAGAATCCATGTGTGATCTTGGG + Intergenic
969000814 4:3979890-3979912 AACAACCAATTTTGGATTGTAGG + Intergenic
971096755 4:23414668-23414690 AAGAAATAATGTTGGATCTTAGG + Intergenic
972275428 4:37552912-37552934 AGAGACCCATGTTGGATTTTGGG - Intronic
974726958 4:65810469-65810491 AAGAACCCACGTTGAATATTGGG - Intergenic
981464071 4:145046712-145046734 AACAACCTATGTAGGTTATTTGG - Intronic
985498968 5:228620-228642 AAAACCCCATGTTGACTCTTTGG - Intronic
988955395 5:36311235-36311257 AACACCCCAATTTTGATCTTCGG + Intergenic
989967109 5:50477354-50477376 AACTACCCAGGTTGCAACTTTGG + Intergenic
993561222 5:89412757-89412779 AAAACCCTTTGTTGGATCTTGGG + Intergenic
995518299 5:112976039-112976061 ACCAATCCATTTGGGATCTTTGG - Intergenic
996552128 5:124742041-124742063 AACAAGTCATGGTGGATCTGGGG - Intronic
996670720 5:126113980-126114002 TACAACCCAAGTTGGAGATTTGG - Intergenic
996839499 5:127831432-127831454 AACAACCCATGTTGCATATTGGG + Intergenic
997571497 5:134931476-134931498 AACAACCTATGTTAGTTCATAGG - Intronic
997868026 5:137482061-137482083 AGCAACCCATGCTGGATGTCGGG + Intronic
1000755357 5:165152283-165152305 AGTAACCCATGCTGGGTCTTGGG + Intergenic
1000914802 5:167067845-167067867 AGCTAGCCAAGTTGGATCTTAGG - Intergenic
1005091613 6:22062572-22062594 AACACCTGATTTTGGATCTTTGG - Intergenic
1010078892 6:71834265-71834287 AACAAAGCATGTTGGAGCTATGG - Intergenic
1013927693 6:115493127-115493149 AAGAACCCATGTTGAATATCGGG - Intergenic
1017056813 6:150443978-150444000 ATCAACCAATGTTAGATATTGGG + Intergenic
1018473608 6:164119041-164119063 ATCAGCCCATGTTGGTTGTTTGG - Intergenic
1019815032 7:3193379-3193401 AAGAACCCATGTGGCATCTCAGG - Intergenic
1021490350 7:21213154-21213176 AACAAACCATTATGTATCTTTGG + Intergenic
1023364473 7:39450179-39450201 AACACCCCAGGCTGGCTCTTAGG + Intronic
1025753078 7:64310675-64310697 AACATGCCATGATGAATCTTAGG - Intronic
1030487958 7:110194569-110194591 AACAAAACATGTTGCAGCTTGGG - Intergenic
1035959951 8:4125968-4125990 AACCACCGATCTTAGATCTTAGG - Intronic
1036075429 8:5494076-5494098 AAGAACTCATGTTGGTTCCTTGG - Intergenic
1048530019 8:135239451-135239473 GACCACCAATGTTGCATCTTGGG - Intergenic
1051194077 9:14544264-14544286 AACAACCCAAGATAAATCTTTGG + Intergenic
1053342689 9:37351244-37351266 AACAACCCATTTTTTCTCTTTGG + Intronic
1056260301 9:84841889-84841911 AACATCCCAGGTTGAATCTAGGG + Intronic
1189213591 X:39304704-39304726 ATGAAGCCATGTTGGAACTTTGG + Intergenic
1191654470 X:63581176-63581198 AAGAACTCACGTTGGATCATTGG - Intergenic
1196939148 X:120758732-120758754 AACCACCCATTTCAGATCTTTGG - Intergenic