ID: 949276163

View in Genome Browser
Species Human (GRCh38)
Location 3:2284343-2284365
Sequence TTGATATGTATACTATAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 557}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949276163_949276165 3 Left 949276163 3:2284343-2284365 CCAATCTATAGTATACATATCAA 0: 1
1: 0
2: 0
3: 24
4: 557
Right 949276165 3:2284369-2284391 TTAGCTTGCTCTGGTGTTCAAGG 0: 1
1: 0
2: 3
3: 13
4: 221
949276163_949276166 6 Left 949276163 3:2284343-2284365 CCAATCTATAGTATACATATCAA 0: 1
1: 0
2: 0
3: 24
4: 557
Right 949276166 3:2284372-2284394 GCTTGCTCTGGTGTTCAAGGTGG 0: 1
1: 0
2: 2
3: 22
4: 497
949276163_949276164 -6 Left 949276163 3:2284343-2284365 CCAATCTATAGTATACATATCAA 0: 1
1: 0
2: 0
3: 24
4: 557
Right 949276164 3:2284360-2284382 TATCAAAACTTAGCTTGCTCTGG 0: 1
1: 0
2: 0
3: 4
4: 138
949276163_949276167 21 Left 949276163 3:2284343-2284365 CCAATCTATAGTATACATATCAA 0: 1
1: 0
2: 0
3: 24
4: 557
Right 949276167 3:2284387-2284409 CAAGGTGGCTTTATACTGTTTGG 0: 1
1: 0
2: 0
3: 4
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949276163 Original CRISPR TTGATATGTATACTATAGAT TGG (reversed) Intronic
901065874 1:6494300-6494322 TTTATATTTATAGTAGAGATGGG + Intronic
901531458 1:9855972-9855994 TTGATATTTTTAGTAGAGATGGG - Intronic
902644347 1:17788118-17788140 TTGATATCTATGCTATACACAGG - Intronic
903277386 1:22230865-22230887 TAGATAAGTAAACTATGGATGGG - Intergenic
906072387 1:43026483-43026505 TTGGTATTTTTACTAGAGATGGG - Intergenic
907367969 1:53978378-53978400 TTGAGATGCAGATTATAGATAGG + Intergenic
908764665 1:67543593-67543615 TTTATATTTTTACTAGAGATGGG + Intergenic
909446213 1:75751668-75751690 TTGATATTTTTAGTAGAGATGGG + Intronic
910266130 1:85339754-85339776 TTGATAAGTATCCTATTGCTTGG - Intronic
910410260 1:86935633-86935655 TTTATATGTTTAGTAGAGATGGG + Intronic
910506702 1:87957591-87957613 TATATATGTATATAATAGATAGG - Intergenic
910654566 1:89606581-89606603 CTGACATTTATTCTATAGATGGG + Intergenic
911029471 1:93470699-93470721 TTTATATGTTTAGTAGAGATGGG - Intronic
912545665 1:110449379-110449401 TTTATATTTTTACTAGAGATGGG + Intergenic
912547656 1:110462572-110462594 TTGAAATGTATATTTTAAATGGG + Intergenic
912851277 1:113127401-113127423 TTGATATTTTTAGTAGAGATGGG + Exonic
913609691 1:120497992-120498014 TTTATATACATACTATATATAGG + Intergenic
915155492 1:153872144-153872166 TTCATATGTTTAGTAGAGATGGG - Intronic
915418971 1:155764610-155764632 TTGTTATTTTTAATATAGATGGG + Intronic
915657576 1:157374436-157374458 TTGAAATGTACACTTTAAATGGG + Intergenic
915671503 1:157492550-157492572 TTGAAATGTACACTTTAAATGGG - Intergenic
915942359 1:160126640-160126662 TATATATGTATATTAGAGATGGG + Intronic
917166830 1:172121823-172121845 TTGATATGAATATTAAATATTGG + Intronic
917378348 1:174375891-174375913 TTGATATTTTTAGTAGAGATAGG - Intronic
917520796 1:175747187-175747209 TTGATATTTTTAATAGAGATGGG + Intergenic
918279459 1:182989599-182989621 TTTATATTTTTACTAGAGATGGG - Intergenic
919039268 1:192361715-192361737 TTTATATTTTTAGTATAGATGGG + Intronic
919452050 1:197784317-197784339 TTTATATTTTTACTAGAGATAGG - Intergenic
919623442 1:199887931-199887953 TTTATATTTTTACTAGAGATGGG + Intergenic
919964682 1:202510811-202510833 TTGATATGTATTATAGATATTGG + Intronic
920225639 1:204436908-204436930 TTGAAATGTATAGCATAGAGTGG + Intronic
920521908 1:206634217-206634239 TTTATATGTATATCATAGAAAGG + Intergenic
921277080 1:213531284-213531306 CTGATATCTATAATATAGTTTGG + Intergenic
923311934 1:232743674-232743696 TTTATATGTTTAGTAGAGATGGG + Intergenic
923500146 1:234557889-234557911 TGTATATATATACTATATATAGG - Intergenic
923697178 1:236264670-236264692 TTTATATTTATAGTAGAGATGGG - Intronic
923953256 1:238985258-238985280 TTTATATTTGTAGTATAGATGGG + Intergenic
924535140 1:244929130-244929152 TTGATATTTTTAGTAGAGATGGG + Intergenic
1063500622 10:6550443-6550465 TTTATATGTTTAGTAAAGATGGG + Intronic
1064181388 10:13119120-13119142 CTGAAATGTATACTTTAAATGGG - Intronic
1064709847 10:18111880-18111902 TTTATATGTTTAGTATAGATGGG - Intergenic
1064951044 10:20850778-20850800 TAGATATGTATCGTATATATGGG + Intronic
1064971010 10:21067142-21067164 TTGGTATTTATAGTAGAGATGGG + Intronic
1065128697 10:22599187-22599209 TTGAGTTGTATACTTTAAATAGG - Intronic
1065345546 10:24744641-24744663 TGTATATGTATAGTAGAGATGGG - Intergenic
1066095137 10:32065141-32065163 TTGTTATGTTTAGTAGAGATGGG + Intergenic
1066605898 10:37170484-37170506 TTGTTATGTTTAGTAGAGATGGG - Intronic
1066606681 10:37182276-37182298 TTGTTATGTTTAGTAGAGATGGG - Intronic
1066607453 10:37194021-37194043 TTGTTATGTTTAGTAGAGATGGG - Intronic
1067358532 10:45554745-45554767 TTTATATTTTTACTAGAGATGGG - Intronic
1069406418 10:68104557-68104579 TTGATATGTAGACTGGAGTTAGG - Intergenic
1069550076 10:69357958-69357980 TTGAATTGTATACTTTAAATGGG + Intronic
1070310156 10:75267136-75267158 TTGAATTGTATACTTTAAATGGG + Intergenic
1071193072 10:83124898-83124920 TTTCTGTATATACTATAGATAGG - Intergenic
1073808376 10:107125122-107125144 TTTATATTTTTACTAAAGATGGG + Intronic
1074354682 10:112771577-112771599 TTGAATTGTATACTTTAAATGGG - Intronic
1074929893 10:118113594-118113616 TTGATATGTATACGTGAGAATGG + Intergenic
1075173856 10:120141630-120141652 TCTATATATATACTATATATAGG - Intergenic
1075369052 10:121919384-121919406 TTGATATTTTTAGTAGAGATGGG - Intronic
1075436927 10:122451444-122451466 CTGAAATGTATACTTTAAATGGG - Intergenic
1077561527 11:3265021-3265043 TTTATATTAATACTAGAGATGGG + Intergenic
1077567423 11:3310849-3310871 TTTATATTAATACTAGAGATGGG + Intergenic
1077595799 11:3530306-3530328 TTGATTTGTTTACTTTAAATTGG - Intergenic
1078194753 11:9126287-9126309 TTGAATTGTATACTTTAAATTGG - Intronic
1078901225 11:15644456-15644478 TTTATATGTATACTTTAAAAAGG + Intergenic
1079033522 11:17003160-17003182 TTGATATTTTTAGTAGAGATGGG + Intronic
1079231733 11:18655036-18655058 TTTATATTTGTACTAGAGATGGG + Intergenic
1079459277 11:20665887-20665909 TTGAATTGTATACTTTAAATGGG - Intergenic
1080372259 11:31664944-31664966 TTGAGATGCATACTACAGCTTGG - Intronic
1080594161 11:33754450-33754472 TTGACATGTTTATTATAGGTAGG - Exonic
1080671091 11:34378813-34378835 TTCATATTTTTACTAGAGATGGG + Intergenic
1081241805 11:40715851-40715873 TTTATATTTTTACTAGAGATAGG - Intronic
1081266834 11:41034527-41034549 TTTATATATATAATATAAATTGG + Intronic
1081400601 11:42637659-42637681 TTAACATTTATACTGTAGATGGG - Intergenic
1081689833 11:45070392-45070414 TTGGTATTTATAGTAGAGATGGG - Intergenic
1081881021 11:46452068-46452090 TTGAAATGTATACTTTAAATAGG + Intronic
1083321079 11:61847240-61847262 TTGATTTGTCTACTTTAAATGGG - Intronic
1083353230 11:62046195-62046217 TTTATATGTGTAGTAGAGATGGG - Intergenic
1083561410 11:63676142-63676164 TTTATATTTTTACTAGAGATGGG - Intergenic
1084251693 11:67904285-67904307 TTGATTTGTTTACTTTAAATGGG - Intergenic
1085017471 11:73184745-73184767 TTGAATTGTATACTTTAAATGGG + Intergenic
1085166428 11:74404519-74404541 TTGAATTGTATACTTTAAATGGG - Intergenic
1085632391 11:78129245-78129267 TTTATATTTTTACTAGAGATGGG - Intronic
1086274111 11:85104675-85104697 TTGAATTGTATACTTTAAATGGG + Intronic
1086363603 11:86085640-86085662 TATATATGTATATTATATATAGG - Intergenic
1086403701 11:86482131-86482153 TTGATATTAATACTATCTATGGG + Intronic
1087733461 11:101805201-101805223 TTCATTTGCATACTATATATTGG - Intronic
1088126586 11:106433388-106433410 TTTGTATTTATAGTATAGATGGG - Intergenic
1088418581 11:109617680-109617702 TTTGTATGTTTACTAGAGATGGG - Intergenic
1088528505 11:110783184-110783206 TTTATATTTATATTATACATTGG - Intergenic
1088781734 11:113141456-113141478 TTGATATTTTTACTAGAGACAGG - Intronic
1089780622 11:120870916-120870938 TTTGTATTTATACTAGAGATGGG + Intronic
1090288925 11:125524894-125524916 CTGAATTGTATACTGTAGATGGG + Intergenic
1092421965 12:8339077-8339099 TTGATTTGTTTACTTTAAATTGG - Intergenic
1093050074 12:14494369-14494391 ATTATATGAATACTATATATAGG - Intronic
1093290293 12:17311562-17311584 TTGATGTGTATATTATACAGTGG - Intergenic
1094128922 12:27053859-27053881 TTGAATTGTATACTGTAAATGGG + Intronic
1095191837 12:39266818-39266840 TTTATATTTATAGTAGAGATGGG - Intergenic
1095277128 12:40299632-40299654 CTGTTTTGTATACTATAGAGGGG + Intronic
1095479697 12:42622308-42622330 TTAATGTGTATGCTGTAGATGGG + Intergenic
1095521430 12:43071486-43071508 TTGAAATGTATACTTTTGTTGGG + Intergenic
1096132554 12:49171583-49171605 TTGAATTGTATACTTTAAATGGG + Intergenic
1096303337 12:50451524-50451546 TTCATATTTTTACTAGAGATGGG - Intronic
1096566169 12:52481363-52481385 TTTATATTTATTGTATAGATGGG - Intergenic
1096645409 12:53031445-53031467 TTGATATTTTTTCTAAAGATGGG + Intronic
1096761640 12:53846508-53846530 TTACTATTTATACTATAAATAGG + Intergenic
1097111339 12:56660722-56660744 TTTATATTTTTACTAGAGATGGG - Intergenic
1097596685 12:61641928-61641950 TTGATAAGTATTCTATAAATAGG - Intergenic
1098274663 12:68801249-68801271 TTTATATTTTTACTAGAGATGGG - Intergenic
1098690583 12:73482392-73482414 TTTATATGTTTAATAGAGATGGG + Intergenic
1098707608 12:73710765-73710787 TATATATATATACTATATATAGG - Intergenic
1099114454 12:78607143-78607165 TTTAAATGTATTTTATAGATAGG + Intergenic
1099368080 12:81794980-81795002 TTTATGTGTATACTTTAGAGTGG - Intergenic
1099368199 12:81796105-81796127 TTTATATGTACAATATAGTTTGG + Intergenic
1099519590 12:83643800-83643822 TTTTTATGTATGGTATAGATAGG + Intergenic
1099654847 12:85477011-85477033 TTGATGTGTATGCTATATACAGG + Intergenic
1099958785 12:89376990-89377012 ATGATATGTTGACTATAGAAGGG + Intergenic
1100335768 12:93627666-93627688 TTGAATTGTATACTTTAAATGGG - Intergenic
1100393105 12:94161276-94161298 TTGATCTGTAAAATACAGATGGG - Intronic
1100827143 12:98485195-98485217 TTGGTATTTTTACTAGAGATGGG - Intergenic
1101721497 12:107354259-107354281 TTGATTTGTATACCTTAAATAGG - Intronic
1101795938 12:107973821-107973843 TTGAAATGTACACTTTAAATAGG - Intergenic
1102121764 12:110447599-110447621 TTGATATTTTTAGTAGAGATGGG - Intronic
1102361295 12:112290147-112290169 TTGGTATGTTTTGTATAGATGGG - Intronic
1102864695 12:116365042-116365064 TTTATATTTTTACTAGAGATGGG - Intergenic
1103545394 12:121697626-121697648 TTGGTATCTTTACTAGAGATGGG + Intergenic
1103878354 12:124146865-124146887 TTTATATTTTTAGTATAGATGGG + Intronic
1104260038 12:127173787-127173809 TTAATTTGTATACTTTAAATAGG + Intergenic
1104435329 12:128751546-128751568 TTGAATTGTATACTTTAAATGGG + Intergenic
1105506863 13:21017795-21017817 TTTATATTTTTACTAGAGATGGG + Intronic
1106040675 13:26088575-26088597 TTGAAATGTATACTTTAGAAGGG - Intergenic
1107199800 13:37700735-37700757 TTTATATGTATAAATTAGATGGG - Intronic
1107318206 13:39157212-39157234 TTGGTATGTTTAGTAGAGATGGG - Intergenic
1107581960 13:41799806-41799828 TTGAATTGTATACTTTAAATAGG - Intronic
1107745291 13:43499342-43499364 TTGATAAATATACTATATTTAGG + Intronic
1108369187 13:49750818-49750840 TTGATATTTTTAGTAGAGATGGG - Intronic
1108387992 13:49919243-49919265 TTTATATTTTTACTAGAGATGGG - Intronic
1108632115 13:52294915-52294937 TTGATATTTTTAGTAGAGATGGG - Intergenic
1108654585 13:52517679-52517701 TTGATATTTTTAGTAGAGATGGG + Intergenic
1109132557 13:58606236-58606258 CTGATATGTATGCTATGGCTAGG - Intergenic
1109965407 13:69686668-69686690 TTCATATGTATCATATATATGGG + Intergenic
1110025772 13:70537412-70537434 TAGATAGGAATAATATAGATAGG - Intergenic
1111129184 13:83952324-83952346 TTGGTATTTTTAGTATAGATGGG - Intergenic
1111708610 13:91783079-91783101 TTGGTATGTTTAGTAGAGATGGG - Intronic
1112469575 13:99675383-99675405 TTGAACTGTATACTTTAAATAGG - Intronic
1112963569 13:105159241-105159263 TTGATATGCATTCCATAAATAGG + Intergenic
1113866611 13:113530326-113530348 TTGAATTGTATACTTTAAATGGG + Intronic
1114863056 14:26551005-26551027 TTCATATGTGGACTCTAGATTGG - Intronic
1115817627 14:37179573-37179595 TTTATATTTTTACTAGAGATGGG - Intergenic
1115938291 14:38579779-38579801 TTGAACTGTATACTTTAAATGGG + Intergenic
1116454937 14:45108934-45108956 TTGAACTGTATACTTTAAATGGG - Intronic
1117130058 14:52677342-52677364 TTGATATATATTATATATATAGG - Intronic
1117262899 14:54055139-54055161 TTGAAATGTATACTTTAAAAAGG + Intergenic
1117550831 14:56834300-56834322 TTGATATTTTTAGTAGAGATGGG + Intergenic
1119362826 14:74065715-74065737 CTGGTATATTTACTATAGATTGG - Exonic
1120011729 14:79423199-79423221 TTGATATGTTTGCTACACATGGG - Intronic
1120390007 14:83894237-83894259 TTGCTATGTATACCTCAGATTGG - Intergenic
1121088186 14:91162723-91162745 TTTATATTTTTAGTATAGATGGG - Intronic
1121139308 14:91526960-91526982 TTGATTTGTCAAGTATAGATCGG - Intergenic
1122095420 14:99367020-99367042 TTGATTTGTATGCTTTAAATTGG - Intergenic
1123009744 14:105342760-105342782 TTTATATTTTTACTAGAGATGGG - Intronic
1123680832 15:22762334-22762356 TTGATATTTTTAGTAGAGATCGG + Intergenic
1124333043 15:28836792-28836814 TTGATATTTTTAGTAGAGATCGG + Intergenic
1124782199 15:32646621-32646643 TAGAATTGTATACTATAGCTAGG + Intronic
1125621126 15:41063163-41063185 TTGGTATTTTTACTAGAGATGGG - Intronic
1125957023 15:43797562-43797584 TTTATATTTTTACTAGAGATGGG + Exonic
1126266877 15:46765412-46765434 GTGATATGTATCCTAAAGGTAGG - Intergenic
1126431070 15:48585315-48585337 TTTATAAGTAAACAATAGATTGG - Intronic
1126463117 15:48935038-48935060 TTGAATTGTATACTTTAAATGGG + Intronic
1126611947 15:50538609-50538631 TTGAATTGTATACTCTAAATGGG + Intronic
1127672455 15:61208511-61208533 TTGAATTGTATACTTAAGATGGG + Intronic
1127680026 15:61285481-61285503 TTCATATGCATATTATAGTTTGG - Intergenic
1127930381 15:63592605-63592627 TTAATATTTTTACTAGAGATGGG + Intronic
1129292932 15:74582337-74582359 TTTATATTTTTAATATAGATGGG + Intronic
1129565376 15:76616686-76616708 TTCATATCTATACTATATTTAGG - Intronic
1129929018 15:79393591-79393613 ATGATAGGTATATTATAGATTGG + Intronic
1131038387 15:89240847-89240869 TTTATATTTTTACTAGAGATAGG + Intergenic
1132499212 16:277376-277398 TTGGTATGTTTAGTAGAGATGGG + Intronic
1133481848 16:6178354-6178376 TTGGTATTTTTAGTATAGATGGG + Intronic
1133526387 16:6609834-6609856 TTCATATATTTACTAAAGATGGG - Intronic
1133647260 16:7775981-7776003 TTGAAATGTACACTTTAAATAGG + Intergenic
1134171092 16:11970382-11970404 TTGGTATTTTTACTACAGATGGG + Intronic
1134501208 16:14770453-14770475 TTTGTATTTTTACTATAGATGGG - Intronic
1134605638 16:15569042-15569064 TTCATATTTTTACTAGAGATGGG - Intronic
1134755270 16:16661550-16661572 TTGTTATGTAGAGGATAGATAGG + Intergenic
1135088826 16:19495959-19495981 TTTATATTTTTACTAGAGATGGG - Intronic
1135184563 16:20304215-20304237 TTTATATTTATAGTAGAGATGGG + Intergenic
1135711282 16:24719486-24719508 TTTATATTTTTAGTATAGATGGG - Intergenic
1136353628 16:29729046-29729068 TTTATATTTTTACTAGAGATGGG + Intergenic
1136371477 16:29839428-29839450 GTGAATTGTATACTCTAGATGGG + Intronic
1136604748 16:31325762-31325784 TTGAAATGTATGCTTTAAATAGG - Intronic
1138177069 16:54909949-54909971 TTGATATTTTTAATAGAGATGGG - Intergenic
1140464620 16:75170511-75170533 CTGATATGTATTCTTTAGCTGGG - Exonic
1140523082 16:75598828-75598850 TTAAAATGTATACTTTAGTTGGG + Intronic
1140545324 16:75802346-75802368 TTCATATATATACTTGAGATAGG - Intergenic
1141202144 16:81906388-81906410 TTGATATGTATGTTATATCTAGG - Intronic
1142604272 17:1073006-1073028 TTTATATTTTTACTAGAGATGGG - Intronic
1143136108 17:4713321-4713343 TTTATATTTTTAGTATAGATGGG - Intronic
1143708398 17:8716550-8716572 TTTGTATGTTTAGTATAGATGGG - Intergenic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1144273047 17:13637771-13637793 TTTATATGTTTAGTAGAGATGGG - Intergenic
1144465868 17:15496794-15496816 TGGATTTTTATTCTATAGATGGG + Intronic
1144526401 17:15994122-15994144 TTGGTATGTTTAGTAGAGATGGG + Intronic
1145224640 17:21117794-21117816 TTTCTATGTTTACTAGAGATGGG - Intergenic
1146047726 17:29523865-29523887 TTGATATTTAAACTATAAAATGG + Intronic
1146366159 17:32230035-32230057 CTTATATGTAAACTATAAATAGG - Intronic
1146378703 17:32312689-32312711 TTTATATGTTTAGTAGAGATGGG + Intronic
1147444614 17:40467258-40467280 TTTATATTTTTACTAGAGATGGG + Intergenic
1148165338 17:45480114-45480136 TTGAACTGTATACTTTAAATGGG - Intronic
1148426841 17:47606046-47606068 TTTATATTTATAATAGAGATGGG + Intronic
1150396569 17:64826835-64826857 TTGAACTGTATACTTTAAATGGG - Intergenic
1151488595 17:74418203-74418225 TTGATATTTTTAGTAGAGATGGG - Intergenic
1151859466 17:76749097-76749119 CTGAAGTGTATACTTTAGATGGG - Intronic
1151939702 17:77284799-77284821 TTTATATTTTTACTAGAGATGGG + Intronic
1152999933 18:445486-445508 TTGAATTGTATACTTTAAATGGG - Intronic
1153304193 18:3617425-3617447 TTTATATTTTTACTAGAGATGGG - Intronic
1155104313 18:22646185-22646207 TTTATATTTATAGTAGAGATGGG - Intergenic
1155224313 18:23715223-23715245 TTGGCATGTACACTTTAGATGGG + Intronic
1155715543 18:28938298-28938320 TTGGAATGTTTACTAGAGATGGG - Intergenic
1156552949 18:38037550-38037572 TTAATATGGATACCATAAATTGG + Intergenic
1158183292 18:54742529-54742551 TTGCTATGTCTGCAATAGATTGG + Intronic
1158330209 18:56354170-56354192 CTGAAATGTATACTTTAAATGGG - Intergenic
1158614340 18:58972277-58972299 CCAATATGTATAATATAGATCGG + Intronic
1159494054 18:69177652-69177674 TTGAATTGTACACTTTAGATGGG - Intergenic
1159620968 18:70637840-70637862 TTGATATGAATATTATATGTTGG - Intronic
1161789683 19:6351881-6351903 TTGGTATGTTTAGTACAGATGGG - Intergenic
1161948166 19:7451891-7451913 TTGATATTTGTAGTAGAGATGGG + Intronic
1162210625 19:9088712-9088734 TTTGTATGTTTACTAGAGATGGG - Intergenic
1162347715 19:10130154-10130176 TTTGTATTTATACTAGAGATGGG + Intergenic
1162543588 19:11314304-11314326 TTGAACTGTATACTTTAGAAAGG + Intronic
1162938091 19:13991831-13991853 TTTATATTTTTAGTATAGATGGG + Intronic
1162942499 19:14020990-14021012 TTTATATATATAATATAAATAGG - Intergenic
1163082115 19:14951687-14951709 TTGATATTTTTAGTAGAGATGGG + Intronic
1163942033 19:20504009-20504031 CTGATATGTGTAGTATAGAAAGG + Intergenic
1164738136 19:30557328-30557350 CTGCTATATATACTGTAGATTGG - Exonic
1165862551 19:38916832-38916854 TTTATATTTTTAGTATAGATGGG + Intronic
1165873151 19:38987417-38987439 TTTATATTTATAGTAGAGATGGG + Intergenic
1167346759 19:48950656-48950678 TTGATATTTTTATTAGAGATAGG - Intergenic
1168398970 19:56072292-56072314 TTTATATTTATAGTAGAGATGGG - Intergenic
925494627 2:4432936-4432958 TTGATTTGTATGCTACAGTTAGG + Intergenic
926708496 2:15855534-15855556 TTTATATTTATAGTAGAGATGGG - Intergenic
927656411 2:24950673-24950695 TTTATATGTTTAGTAGAGATGGG - Intronic
930213874 2:48672802-48672824 TTGAATTGTATACTTTAAATAGG - Intronic
930623945 2:53675279-53675301 TTTATATGTAAAATATATATTGG - Intronic
930751303 2:54937106-54937128 TTTATATGTTTAGTAGAGATGGG - Intronic
931266290 2:60663242-60663264 TTGAATTGTATACTTTAAATAGG - Intergenic
931503040 2:62891670-62891692 TTAATATATATATTATATATTGG + Intronic
932506530 2:72237944-72237966 TTGAGATGTATACTTTAAATGGG - Intronic
933115554 2:78465544-78465566 TTTATATGTAATCTATAAATAGG + Intergenic
933204955 2:79496111-79496133 TTGAATTGTATACTTTAAATGGG + Intronic
933465540 2:82646440-82646462 TTGATATTTGGACTATTGATTGG - Intergenic
933470524 2:82717083-82717105 TAGACATAGATACTATAGATAGG - Intergenic
933518757 2:83343630-83343652 TTGCTATGTATACTTTAGTGGGG + Intergenic
934112810 2:88758075-88758097 TTGAAATGTTTTCTAGAGATAGG + Intergenic
937729658 2:125213254-125213276 TTGATATTTTTAGTAGAGATAGG + Intergenic
937823852 2:126343126-126343148 TTGAACTGTATACTTTAAATGGG + Intergenic
937945055 2:127325913-127325935 TTGACTTGTATACTTTAAATGGG - Intronic
938340837 2:130535229-130535251 TTGATATTTTTAGTAGAGATGGG + Intergenic
938348994 2:130585480-130585502 TTGATATTTTTAGTAGAGATGGG - Intergenic
938489239 2:131753173-131753195 TTGATATGTATATCATATCTTGG + Intronic
938858813 2:135344562-135344584 TTGTTATTTTTACTAGAGATGGG - Intronic
939117974 2:138082934-138082956 ATGATATGTATACTGTATACAGG + Intergenic
939318488 2:140583345-140583367 TTTATATTTTTAGTATAGATGGG + Intronic
940062334 2:149586595-149586617 TACATATGAATTCTATAGATAGG + Intronic
940252793 2:151698268-151698290 TTGAATTGTATACTTTAAATTGG - Intronic
940546716 2:155098628-155098650 TTGAAATGTACACTTTAAATGGG + Intergenic
940813695 2:158274969-158274991 TTTATATGAATTCTATAAATTGG + Intronic
941145252 2:161835920-161835942 TTGAGGTATATACTGTAGATTGG + Intronic
941774102 2:169373201-169373223 TGGATATGTATTATATAGTTTGG + Intergenic
942350367 2:175046281-175046303 TTGGTATTTTTACTAGAGATGGG + Intergenic
942502975 2:176611494-176611516 TTAAAATGTATACTTTAAATGGG - Intergenic
942549146 2:177096306-177096328 TTTATTTGTATACTATGGAAGGG - Intergenic
942705591 2:178768231-178768253 TTGAATTGTATACTTTAAATTGG - Intronic
942806058 2:179932135-179932157 TTGGTATTTTTACTAGAGATGGG + Intergenic
943189244 2:184654672-184654694 TTCATATGGATACAATAAATTGG - Intronic
944731837 2:202524859-202524881 TTGATATTTTTAGTAGAGATGGG - Intronic
944814558 2:203362696-203362718 TTTATATGTTTAGTAGAGATGGG + Intronic
946988159 2:225297991-225298013 TGGATTTTTATACTATAGATTGG + Intergenic
947027373 2:225751765-225751787 TTTATATTTTTACTAGAGATAGG + Intergenic
947634674 2:231673953-231673975 TTGATATTTTTAGTAGAGATGGG + Intergenic
948029755 2:234807700-234807722 TTGATATTTTTAGTAGAGATGGG + Intergenic
949071460 2:242027524-242027546 TTTATATTTTTACTAGAGATGGG + Intergenic
1168738900 20:171502-171524 TTGAAATGAATACTATAGTCAGG + Intergenic
1168863805 20:1066543-1066565 TTTCTATGTATACTTTAGTTTGG + Intergenic
1168900400 20:1359032-1359054 TGGAAATGTATACTTTAAATGGG - Intronic
1170073475 20:12393816-12393838 ATAATATGTATATTATATATTGG + Intergenic
1170222226 20:13952855-13952877 TTTATATGTTTAATAGAGATGGG - Intronic
1170412084 20:16102984-16103006 TTTATATGTATACAAGAGAAGGG + Intergenic
1170668575 20:18408142-18408164 TTTATATTTATAGTAGAGATGGG - Intronic
1171455346 20:25268460-25268482 TTCATATGTATACTTTAAAAAGG + Intronic
1171946427 20:31382400-31382422 CTCATATGTATAGTATAGACCGG + Intronic
1172074924 20:32288315-32288337 TTCATATGTTTTGTATAGATGGG - Intronic
1172323252 20:34013870-34013892 TTGATACTTATAGTATAGTTTGG + Intronic
1172369101 20:34373445-34373467 TTTATATTTTTACTAGAGATGGG + Intronic
1173452895 20:43180761-43180783 TTTAAATGTATATTATATATTGG - Intronic
1173598528 20:44276148-44276170 TTGGTATTTTTACTAGAGATGGG - Intronic
1174389549 20:50209656-50209678 TTTATATCTTTAGTATAGATGGG + Intergenic
1174473792 20:50781375-50781397 TTGAAACGTATACTTTAAATAGG + Intergenic
1174758663 20:53184877-53184899 TTTATATTTTTAGTATAGATGGG + Intronic
1176225017 20:63992431-63992453 TTCATATTTTTAGTATAGATGGG + Intronic
1176926251 21:14752952-14752974 TTGAAATGCGTACTATAAATAGG - Intergenic
1177289525 21:19093644-19093666 TTCATATTTTTACTAAAGATTGG + Intergenic
1177462302 21:21428695-21428717 TTGTGATGTATAAGATAGATAGG + Intronic
1178838880 21:36122458-36122480 TTGAATTGTATACTTTAAATGGG + Intergenic
1179106744 21:38407927-38407949 TTCACATATATACTATATATAGG - Intronic
1179620433 21:42611714-42611736 TTCATATTTTTACTAGAGATGGG - Intergenic
1180894087 22:19315276-19315298 TTGGTATGTTTAGTATAGACAGG - Intergenic
1183438762 22:37810820-37810842 TTTATATGTTTAGTAGAGATGGG + Intronic
1183798260 22:40138971-40138993 TTGAGCTGTATACTATAAATGGG - Intronic
949276163 3:2284343-2284365 TTGATATGTATACTATAGATTGG - Intronic
949349837 3:3114215-3114237 TTTATATTTTTACTAGAGATGGG + Intronic
949479605 3:4481055-4481077 TTGAATTGTATACTTTATATGGG - Intergenic
949525312 3:4897541-4897563 TTTATATGTTTACTAGAGACAGG - Intergenic
949851201 3:8422199-8422221 TTGATATTTTTAGTAGAGATGGG - Intergenic
950241647 3:11375729-11375751 TTTATATTTTTACTAGAGATGGG + Intronic
952077707 3:29718064-29718086 TTAATCTCTATACTAAAGATAGG - Intronic
952486316 3:33814988-33815010 TGTATATGTATACTATAAAAAGG - Intronic
954070903 3:48142227-48142249 TTTATATGTTTAGTAGAGATGGG + Intergenic
954190302 3:48955024-48955046 TTGGTATTTTTACTAGAGATGGG - Intronic
955202489 3:56863469-56863491 TTCATATTTTTACTAGAGATGGG + Intronic
955960833 3:64339901-64339923 TTGAGTTGTATACTTTATATGGG + Intronic
957025781 3:75180114-75180136 TAGATATGTATACTTTAAATAGG + Intergenic
957396785 3:79649833-79649855 TTGATATGTCTTCTGGAGATCGG + Intronic
957749456 3:84393922-84393944 GTGATATGTACACAATAAATAGG + Intergenic
958115272 3:89208196-89208218 TTGATATTTTTAGTAGAGATGGG - Intronic
958586506 3:96093788-96093810 TTGATCTGTCTACTATTGACAGG - Intergenic
958819910 3:98961583-98961605 ATGATATGTATCCTAGAGACAGG + Intergenic
959799766 3:110478671-110478693 TTGATATAGATATTATAGAAAGG - Intergenic
960396006 3:117138293-117138315 TTTATATTTTTACTAGAGATGGG + Intronic
960587845 3:119336680-119336702 TTGACTTGTATACTTTAAATAGG - Intronic
961469739 3:127103950-127103972 TTTATATTTTTACTAGAGATGGG - Intergenic
961870295 3:129982747-129982769 TTGAATTGTACACTTTAGATGGG - Intergenic
961899705 3:130198600-130198622 TTGATTTGTTTACTTTAAATTGG - Intergenic
962034262 3:131634576-131634598 TTGAAATGAATACTTTAGATTGG + Intronic
962188762 3:133288416-133288438 TTTATATGTATTCTTTAAATCGG + Intronic
963142275 3:141956738-141956760 TTGATATGTTTGGTAGAGATGGG - Intronic
963948166 3:151169290-151169312 TTTATATTTTTAGTATAGATTGG + Intronic
964434991 3:156641988-156642010 TTTATATGTTTAGTAGAGATGGG - Intergenic
965574944 3:170208394-170208416 TTGATATTTTTAGTAGAGATGGG - Intergenic
965742730 3:171893005-171893027 TTGAAATGGATACTACAGCTAGG + Intronic
965752050 3:171985513-171985535 TTTATATTTTTACTAGAGATGGG + Intergenic
967077915 3:186021247-186021269 TTTATATGTTTAGTAGAGATGGG - Intergenic
967145757 3:186604514-186604536 TTGATATTTTTAGTAGAGATGGG - Intergenic
967371400 3:188750457-188750479 TTGATATTTGTAGTAGAGATGGG - Intronic
968050746 3:195653397-195653419 TTTATATGTTTACTACAGATGGG + Intergenic
968105073 3:195994950-195994972 TTTATATGTTTACTACAGATGGG - Intergenic
968303372 3:197632541-197632563 TTTATATGTTTACTACAGATGGG - Intergenic
969631512 4:8341441-8341463 TTTATATGTTTAGTAGAGATGGG + Intergenic
970498038 4:16647391-16647413 TTGAGTTGTATACTTTAAATAGG + Intronic
971670597 4:29551134-29551156 TTGATATGAATACTTTAGACTGG + Intergenic
971698928 4:29942860-29942882 TAAATATCTATACTATATATAGG - Intergenic
972049490 4:34711212-34711234 TTCATGTGTATATTATAGAATGG - Intergenic
972330901 4:38063798-38063820 TTTATATGTTTACTAGAGACGGG + Intronic
972332558 4:38077561-38077583 ATGACATTTATAATATAGATGGG - Intronic
973176180 4:47208550-47208572 TTGAATTGTATACTTTAAATGGG + Intronic
973666365 4:53163557-53163579 TTTATATTTTTACTATGGATGGG - Intronic
973999459 4:56496814-56496836 TTTATATTTGTACTAGAGATGGG - Intronic
974051632 4:56947212-56947234 TTTGTATTTATACTAGAGATGGG - Intergenic
974138295 4:57848777-57848799 TGGATTTTTATACTCTAGATTGG + Intergenic
974161518 4:58147409-58147431 TTGTTATATATTCTATTGATAGG - Intergenic
974538532 4:63201442-63201464 TATATATATATAATATAGATAGG + Intergenic
974538533 4:63201476-63201498 TATATATATATACTATAGATAGG + Intergenic
974538537 4:63201564-63201586 AGTATATTTATACTATAGATAGG - Intergenic
974538551 4:63201914-63201936 TGTATATATATACTATATATAGG - Intergenic
975231473 4:71939264-71939286 TTGTTATGGAGACTATAGATAGG + Intergenic
975579090 4:75891009-75891031 TTTATATGTTTAGTAGAGATGGG - Intronic
976147909 4:82060947-82060969 TTGAGATGTCTTCCATAGATAGG - Intergenic
976166258 4:82258191-82258213 TTGAGTTGTATACTCTAAATGGG - Intergenic
976423451 4:84872291-84872313 TTTATATTTTTAGTATAGATGGG - Intronic
976942293 4:90718049-90718071 TTGATTTCTATAGTATAAATGGG - Intronic
977127553 4:93188560-93188582 TTGATAAGGTTACTATGGATTGG - Intronic
977425808 4:96865422-96865444 TTGATATGTCTAATATTGACAGG - Intergenic
977835426 4:101640117-101640139 TTTATATGTTTACTAGAGACGGG + Intronic
979343301 4:119554633-119554655 TTGAAATGTCTACTATTGTTAGG - Intronic
979450274 4:120862636-120862658 TTGATATGTTAACTATTGACAGG - Intronic
979453962 4:120905321-120905343 GTTTTATGTATACTATGGATAGG + Intronic
980276981 4:130665580-130665602 TTGATATTTTTAGTAGAGATGGG + Intergenic
982594888 4:157368577-157368599 TTGATATGATTATTAAAGATAGG + Intergenic
982977311 4:162080559-162080581 TTTATACATATACCATAGATTGG + Intronic
983008790 4:162519641-162519663 TTTGTATGTTTACTAGAGATGGG - Intergenic
983747488 4:171219587-171219609 TTTGTATGTTTACTAGAGATGGG - Intergenic
984153244 4:176160791-176160813 TTGAAATTTATACTATAATTTGG - Intronic
984352240 4:178610798-178610820 GTCATATTTATAGTATAGATAGG + Intergenic
985485335 5:145531-145553 TTTGTATGTTTACTAGAGATGGG + Intronic
986008619 5:3690706-3690728 TTGATAATTATACTATGGACAGG - Intergenic
986755327 5:10830806-10830828 TATATATGTATAATATATATGGG + Intergenic
987339668 5:16928670-16928692 TTGATATTTTTAGTAGAGATGGG - Intronic
988000058 5:25336104-25336126 TTGGTATTTTTACTAGAGATGGG + Intergenic
988154787 5:27437169-27437191 TTGAGATATAAACTAGAGATTGG + Intergenic
988544047 5:32140476-32140498 TTTATATGTTTAGTAGAGATGGG - Intronic
988783106 5:34541486-34541508 ATGATGCGTAAACTATAGATTGG + Intergenic
989136412 5:38160156-38160178 GTGAGATGTATAACATAGATAGG + Intergenic
990288936 5:54329250-54329272 TTTGTATTTATAATATAGATGGG + Intergenic
991457873 5:66823649-66823671 TTTATATGTTTAGTAGAGATGGG + Intronic
991684503 5:69169240-69169262 TTCATATTTTTAGTATAGATGGG + Intronic
992140271 5:73789527-73789549 TTGAAGTGTATACTCTAAATGGG + Intronic
992247452 5:74840654-74840676 TTGATATTTTTAGTAAAGATGGG - Intronic
992783956 5:80152767-80152789 TTTGTATTTTTACTATAGATGGG - Intronic
992953359 5:81882850-81882872 TTCTTATGTATGCTATAAATAGG - Intergenic
993230046 5:85223781-85223803 TTGAGTTGTATACTTTAAATTGG - Intergenic
993392377 5:87335595-87335617 TTGATATTTTTAGTAGAGATGGG + Intronic
993705547 5:91165684-91165706 TTGAAGTGTATACTTTAAATAGG - Intergenic
994034918 5:95187571-95187593 TTGATATTTTTAGTAGAGATAGG + Intronic
995025551 5:107417369-107417391 TTAATATGTATGCTATGTATGGG - Intronic
996150276 5:120026314-120026336 TTGAAATGTACACTTTAAATAGG - Intergenic
996268593 5:121574852-121574874 TTGACATGCATGCTATATATTGG + Intergenic
996337961 5:122405484-122405506 AGGATATTTATATTATAGATGGG + Intronic
996538766 5:124607185-124607207 TTGATATTTTTAGTAGAGATGGG - Intergenic
997000466 5:129753310-129753332 TTTGTATTTTTACTATAGATGGG - Intronic
997516248 5:134491896-134491918 TTAATTTGTACCCTATAGATTGG - Intergenic
997795130 5:136801955-136801977 GTGATATGTATAATAAAGTTTGG - Intergenic
998400818 5:141848265-141848287 TTGATATTTTTAGTAGAGATGGG + Intergenic
998638159 5:143980256-143980278 TTGTTATGTCTACTATATTTGGG - Intergenic
998683900 5:144502647-144502669 TTAATATGTATACTTTACATGGG - Intergenic
998760613 5:145428128-145428150 TTCATATGTTTACTAGAGATGGG + Intergenic
999001369 5:147926919-147926941 TTTATATTTTTACTAGAGATGGG + Intergenic
999170808 5:149593195-149593217 TTGATTTGTACACTTTAAATGGG - Intronic
999921846 5:156329842-156329864 TTGGTATTTTTAGTATAGATGGG - Intronic
1000057094 5:157616753-157616775 TTTATATTTTTAGTATAGATGGG - Intergenic
1000234926 5:159348851-159348873 TTGAATTGTATACTTTAAATGGG - Intergenic
1001213781 5:169835925-169835947 TTGATATTTTTAGTAGAGATGGG + Intronic
1001332812 5:170774010-170774032 TTGTTATGTTTATTATTGATTGG - Intronic
1002195763 5:177500384-177500406 TTTATATGTTTAGTAGAGATGGG + Intergenic
1002858701 6:1060623-1060645 TAGATATATAGATTATAGATAGG - Intergenic
1002982917 6:2159688-2159710 TTGGTATTTTTACTAGAGATGGG + Intronic
1003736793 6:8886693-8886715 TTGATATGAGTACTGTATATTGG + Intergenic
1004399087 6:15271826-15271848 TTTATATTTTTAGTATAGATGGG - Intronic
1005660810 6:27997858-27997880 TTTATATTTTTAGTATAGATGGG - Intergenic
1005974303 6:30786001-30786023 TTTATATTTTTACTAGAGATAGG + Intergenic
1006038232 6:31230806-31230828 TTGAATTGTATACTTTAAATGGG + Intergenic
1006047901 6:31313788-31313810 TTGAATTGTATACTTTAGATGGG + Intronic
1006307548 6:33233287-33233309 TTTGTATTTTTACTATAGATGGG + Intergenic
1007048303 6:38799635-38799657 TTGAGATGTACACTTTAAATGGG - Intronic
1007104792 6:39276146-39276168 TTTGTATTTTTACTATAGATGGG - Intergenic
1007358580 6:41339556-41339578 TTTATATTTTTACTAGAGATGGG + Intronic
1007364364 6:41380770-41380792 TTGAAGTGTATACTTTAAATGGG + Intergenic
1007601639 6:43085760-43085782 TTTATATTTTTACTAGAGATGGG - Intronic
1008666194 6:53718866-53718888 TTGATATGAATAAAAGAGATTGG + Intergenic
1008975246 6:57418571-57418593 TTGATATTTTTAGTATAGATGGG + Intronic
1009160712 6:60278580-60278602 TTGATATCTTTAGTAGAGATGGG + Intergenic
1009164126 6:60320084-60320106 TTGATATTTTTAGTAGAGATGGG + Intergenic
1011433752 6:87315618-87315640 TTGGTATGTTTAGTAGAGATGGG - Intronic
1012163522 6:95919251-95919273 TTAATCTGTCTTCTATAGATGGG - Intergenic
1012293624 6:97491568-97491590 TTGATAAGTATATAATAAATAGG - Intergenic
1012736259 6:102948937-102948959 TTGATATTTATATTATACACTGG + Intergenic
1012773672 6:103476527-103476549 TTGATATGTTTTCGATACATTGG + Intergenic
1012883203 6:104815899-104815921 TTTATATTTATAGTAGAGATGGG - Intronic
1013083320 6:106832156-106832178 TTTGTATGTTTACTAGAGATGGG + Intergenic
1013716114 6:112964295-112964317 TTGATATGTTTTATATATATGGG - Intergenic
1013756959 6:113473165-113473187 TTTATATTTTTAGTATAGATGGG - Intergenic
1014024434 6:116628688-116628710 TTTATATGTTTAATATAGATGGG + Intronic
1015416862 6:132959082-132959104 TTGAAATGTATTCTCTAGTTTGG + Intergenic
1016051999 6:139539409-139539431 TTTATATTTTTACTAGAGATGGG - Intergenic
1017898039 6:158698516-158698538 TGAATATGTGAACTATAGATTGG + Intronic
1018292392 6:162305853-162305875 CAGATATAGATACTATAGATAGG - Intronic
1018305788 6:162453729-162453751 TTGATATTTTTAGTAGAGATGGG - Intronic
1020675680 7:11182312-11182334 TTGAATTGTATACTTTAAATGGG + Intergenic
1021423217 7:20468829-20468851 TTTATATGTTTAGTAGAGATGGG + Intergenic
1022085275 7:27061704-27061726 TTTATATTTTTACTAGAGATGGG + Intergenic
1023935357 7:44736235-44736257 TTGAATTGTATACTTTATATAGG + Intergenic
1024484867 7:49906507-49906529 TTTGTATTTTTACTATAGATGGG + Intronic
1025727143 7:64076437-64076459 TTTGTATGTTTACTAGAGATGGG - Intronic
1026049251 7:66931129-66931151 TTGATATTTTTAGTAGAGATGGG - Intronic
1026050012 7:66938420-66938442 TTGAATTGTATACTTTAAATGGG + Intronic
1026094801 7:67337083-67337105 TTCATATGTTTACTATGTATAGG - Intergenic
1026977827 7:74509183-74509205 TTTATATTTTTACTAGAGATGGG - Intronic
1027686213 7:81281366-81281388 TTCATATGTTTAGTAGAGATGGG + Intergenic
1027787753 7:82601765-82601787 TTGAAATGTATACTTTAAATTGG + Intergenic
1028028760 7:85881285-85881307 ATACTATGTATACTATATATAGG + Intergenic
1029192203 7:98779843-98779865 TTTATATTTTTAGTATAGATGGG + Intergenic
1030120526 7:106106374-106106396 TTGATATTTTTAGTAGAGATGGG - Intronic
1030668277 7:112306384-112306406 TTTATATTTTTAGTATAGATGGG + Intronic
1030839566 7:114331815-114331837 TTTGTATTTTTACTATAGATGGG + Intronic
1032093471 7:128923782-128923804 TTAAATTGTATACTTTAGATGGG - Intergenic
1032204506 7:129850194-129850216 TTTTTATTTATACTAGAGATGGG - Intronic
1032465498 7:132141899-132141921 TTTATATTTTTAGTATAGATGGG + Intronic
1033178519 7:139150444-139150466 TCTAGGTGTATACTATAGATAGG - Intronic
1033562156 7:142542735-142542757 TATATATATATACTATATATAGG - Intergenic
1034621208 7:152458485-152458507 TTTATATTTATAGTAGAGATGGG - Intergenic
1034644692 7:152634650-152634672 TTGATACATAGACAATAGATAGG - Intergenic
1035091988 7:156320386-156320408 TTGATATTTACACCATATATTGG + Intergenic
1035155009 7:156905239-156905261 TTTGTATTTTTACTATAGATGGG + Intergenic
1035558132 8:582200-582222 TTGATATGTATAGGTGAGATTGG - Intergenic
1036118978 8:5993840-5993862 ATGATATGTTTATTATAAATGGG - Intergenic
1036402792 8:8425396-8425418 TTTGTATGTTTACTAGAGATGGG + Intergenic
1037139066 8:15497918-15497940 TTTATATTTTTACTAGAGATGGG + Intronic
1037799158 8:22023011-22023033 TTCATATTTTTACTAGAGATGGG - Intergenic
1038537541 8:28364479-28364501 TTGATATTTTTAGTAGAGATAGG - Intronic
1038990054 8:32858212-32858234 TTGTAATGTATACTAAAGAGAGG - Intergenic
1039529524 8:38248215-38248237 TTGATATTTTTAGTAGAGATGGG + Intronic
1041529175 8:58843263-58843285 TTTATGTGTATCCTTTAGATTGG - Intronic
1041806739 8:61859344-61859366 TTGAATTCTATACTTTAGATGGG - Intergenic
1042139123 8:65661790-65661812 TTGATATTTTTAGTAAAGATGGG - Intronic
1043622274 8:82209453-82209475 TTTATATTTTTAGTATAGATGGG + Intergenic
1043810374 8:84731674-84731696 TTGTTTTGTATACTATAGCCAGG + Intronic
1044109874 8:88259199-88259221 GTTACATGTATACTATATATAGG - Intronic
1044231613 8:89785301-89785323 TTTATATGTTTAGTAGAGATGGG - Intronic
1044512002 8:93092512-93092534 TTGGTATGTTTAGTAGAGATGGG - Intergenic
1046715746 8:117564690-117564712 TTGGTATGTTTAGTAGAGATGGG - Intergenic
1046965431 8:120159861-120159883 TTTATATGTTTAGTAGAGATGGG + Intronic
1047051325 8:121116729-121116751 TTGATTTTTATATTATGGATAGG - Intergenic
1047757978 8:127933244-127933266 TTTATATGTTTAGTAGAGATGGG + Intergenic
1047846458 8:128811080-128811102 TTTGTATTTATAGTATAGATTGG - Intergenic
1048561764 8:135545964-135545986 TTTATATTTTTAGTATAGATGGG - Intronic
1049934249 9:485341-485363 TTGAATTGTATACTTTAAATGGG - Intronic
1050092835 9:2032952-2032974 TTGTCATGTATACCATCGATGGG - Exonic
1050732717 9:8727877-8727899 TTGAATTGTATACTTTAAATGGG - Intronic
1051309567 9:15755916-15755938 TTGATTTGTATACTTTAAATGGG + Intronic
1051382166 9:16470168-16470190 TTTATATTTTTAGTATAGATGGG + Intronic
1051594314 9:18809186-18809208 AAGAGATGTATACTTTAGATGGG - Intronic
1051603606 9:18898002-18898024 TTGATATTTTTAGTAGAGATGGG - Intronic
1052709004 9:32029930-32029952 TTTATGTGTATACTATAAAAAGG - Intergenic
1052897964 9:33766091-33766113 TTTATATTTATAGTAGAGATGGG - Intronic
1052938196 9:34111155-34111177 TTTATATTTTTACTAAAGATGGG + Intronic
1054730310 9:68695724-68695746 TTGAATTGTATACTCTAAATAGG - Intergenic
1055211981 9:73806737-73806759 TTGATAAGTAAAACATAGATGGG + Intergenic
1055418572 9:76110933-76110955 TTTATATGTTTAGTAGAGATGGG - Intronic
1056193707 9:84209099-84209121 TATATATATATACAATAGATTGG + Intergenic
1056248686 9:84725675-84725697 TGCATATGTATAATATATATAGG + Intronic
1056373689 9:85985705-85985727 TTGAATTGTATACTTTAAATAGG + Intronic
1056467410 9:86871232-86871254 TTTGTATGTTTAGTATAGATGGG - Intergenic
1056497450 9:87173055-87173077 TATATATATATACTAGAGATGGG - Intergenic
1056597221 9:88017512-88017534 TTCATATGCATACTCTAAATAGG + Intergenic
1057538940 9:95946353-95946375 TTGATATTTTTACTAGAGACGGG - Intronic
1057992947 9:99791627-99791649 TTGAATTGTATACTCAAGATTGG - Intergenic
1058424597 9:104865342-104865364 TTGATATGTTTAGTAGAGACTGG - Intronic
1058671748 9:107366207-107366229 TTTATATTTTTAGTATAGATAGG - Intergenic
1058900692 9:109439735-109439757 TTTGTATTTATACTAGAGATGGG - Intronic
1058946864 9:109865268-109865290 TTTATATTTTTAGTATAGATGGG + Intronic
1059165644 9:112074043-112074065 TTTATATGTTTAGTAGAGATGGG - Intronic
1059302682 9:113327778-113327800 TTTATATTTATAGTAGAGATGGG - Intronic
1059355271 9:113694401-113694423 TTGAATTGTATACTTTAAATGGG + Intergenic
1059775912 9:117474953-117474975 TTGATATTTTTAGTAGAGATGGG + Intergenic
1060135720 9:121151560-121151582 TTTATATTTTTAGTATAGATGGG + Intronic
1060491710 9:124089966-124089988 TTGGTATTTATACTAGAGTTGGG + Intergenic
1061292244 9:129657394-129657416 TTTATATGTTTAGTAGAGATGGG - Intergenic
1185515972 X:699282-699304 TTTATATGTTTAGTAGAGATGGG + Intergenic
1185529186 X:803627-803649 TTTGTATGTTTACTAGAGATGGG - Intergenic
1185986134 X:4836423-4836445 TTGAATTGTATACTTTAAATGGG - Intergenic
1186053069 X:5620769-5620791 TTAATATGTATCCAATATATTGG - Intergenic
1186999147 X:15157165-15157187 TTTATATTTTTAGTATAGATGGG - Intergenic
1187068839 X:15867705-15867727 TTGAATTGTATGCTATAAATGGG - Intergenic
1187123672 X:16433558-16433580 TATATATGTACATTATAGATTGG + Intergenic
1187173775 X:16876419-16876441 TTGAATTGTATACTTTATATGGG - Intergenic
1187516110 X:19972528-19972550 TTGAATTGTATACTTTAAATGGG - Intergenic
1187689026 X:21845459-21845481 TTCATATTTATATTATGGATAGG - Intronic
1188124639 X:26352372-26352394 TTTGTATGTTTAGTATAGATGGG + Intergenic
1189212292 X:39293872-39293894 TTGATATGTGTACTACAGTTAGG - Intergenic
1190422822 X:50302495-50302517 TTGAATTGTATACTTTAAATGGG - Intronic
1190954672 X:55180992-55181014 TTGATATGGCTAGTATAAATAGG + Intronic
1192241337 X:69332242-69332264 TTTATATCTTTAGTATAGATGGG + Intergenic
1192595284 X:72400657-72400679 TTGAATTGTATACTATGAATGGG - Intronic
1193123730 X:77849697-77849719 TTGATATTTTTAGTAGAGATGGG - Intronic
1193999675 X:88412481-88412503 TTTATATTTTTAGTATAGATGGG - Intergenic
1194099345 X:89683117-89683139 TTGAAATGTATACAAAAGTTTGG - Intergenic
1194644062 X:96436867-96436889 TTGATAGGCATACTGTAGAGAGG + Intergenic
1195507212 X:105671693-105671715 TTTATATTTATACCATATATGGG + Intronic
1195582204 X:106518006-106518028 TTGAACTGTATACTTTAAATGGG - Intergenic
1195918817 X:109962199-109962221 TTTATATTTTTACTAGAGATGGG - Intergenic
1196006222 X:110840018-110840040 TTGATGTTTTTCCTATAGATAGG - Intergenic
1196075564 X:111572049-111572071 TTTATATTTTTAGTATAGATGGG + Intergenic
1196169166 X:112568264-112568286 TTTATATTTTTAGTATAGATGGG - Intergenic
1196729177 X:118923935-118923957 TTTATATTTTTACTATAGAATGG + Intergenic
1196751748 X:119124371-119124393 TTGAATTGTATACTTTAAATAGG + Intronic
1197482254 X:127001906-127001928 TTTATATGTATGCTCTAGGTGGG + Intergenic
1198119013 X:133572970-133572992 TTTATATTTATAATATATATTGG - Intronic
1198405964 X:136312695-136312717 TTGAATTGTATACTTTAAATGGG - Intronic
1198540448 X:137633162-137633184 TGGATCAGTATACCATAGATTGG + Intergenic
1198722988 X:139644295-139644317 TTGATATTTATACTTTGGAATGG - Intronic
1199007070 X:142712938-142712960 TTGAACTGTATACTTTAAATGGG - Intergenic
1199605552 X:149575824-149575846 TTTATATTTTTACTAGAGATGGG - Intergenic
1199633569 X:149793544-149793566 TTTATATTTTTACTAGAGATGGG + Intergenic
1200452351 Y:3344496-3344518 TTGAAATGTATACAAAAGTTTGG - Intergenic
1200804088 Y:7414292-7414314 TTTATATTTTTAGTATAGATGGG + Intergenic
1201254523 Y:12093872-12093894 TTGCTTTGTATACTTTAAATGGG + Intergenic
1201552250 Y:15229857-15229879 ATGATTTGGATACAATAGATGGG + Intergenic
1201772491 Y:17629092-17629114 TTGGTATTTTTACTAGAGATGGG - Intergenic
1201829064 Y:18276894-18276916 TTGGTATTTTTACTAGAGATGGG + Intergenic
1201855925 Y:18541896-18541918 TTCATATTTATAGTAGAGATGGG - Intergenic
1201877396 Y:18778489-18778511 TTCATATTTATAGTAGAGATGGG + Intronic
1202300311 Y:23406653-23406675 TTGATATGTATTGTAGATATTGG + Intergenic
1202570500 Y:26263945-26263967 TTGATATGTATTGTAGATATTGG - Intergenic