ID: 949278334

View in Genome Browser
Species Human (GRCh38)
Location 3:2315373-2315395
Sequence CAGTTTCCCAAACGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949278332_949278334 -8 Left 949278332 3:2315358-2315380 CCAACATGTATTCATCAGTTTCC 0: 1
1: 0
2: 0
3: 23
4: 299
Right 949278334 3:2315373-2315395 CAGTTTCCCAAACGAGAAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949278334 Original CRISPR CAGTTTCCCAAACGAGAAGT GGG Intronic
901408351 1:9065533-9065555 CAGTTTCACAAACAGGTAGTGGG + Intronic
902790859 1:18766922-18766944 CAGTTTCCCCAACTAGAAAATGG - Intergenic
903307282 1:22421982-22422004 CAGTTTCCCCATTAAGAAGTTGG + Intergenic
903654979 1:24943489-24943511 CAGTTTCCCCAACTGTAAGTGGG - Intronic
905956359 1:42000495-42000517 CAGGTTCCCAAAGGAGAAAGAGG + Intronic
908809052 1:67960274-67960296 CAGGTTCCCATACCAGAAATTGG + Intergenic
910493279 1:87796652-87796674 CAGCTTGCCAGAAGAGAAGTAGG + Intergenic
914674539 1:149898658-149898680 CATTTTTCAAAATGAGAAGTTGG + Intronic
915245945 1:154556536-154556558 CAGGTTCCCAAGGGAGAGGTGGG - Intronic
915462010 1:156076053-156076075 CAGTTTCCCAAACAGGATATGGG + Exonic
916578697 1:166089080-166089102 CAGTTGCCCAAGGGAGCAGTGGG - Intronic
919513203 1:198491802-198491824 CAGTTTTCCAAACAAGAAAAAGG + Intergenic
919877810 1:201883362-201883384 TAGTTTTCCAAAAGATAAGTAGG + Exonic
922029143 1:221781291-221781313 CAGTTTCCCCAAAGTGAACTGGG - Intergenic
922441122 1:225655671-225655693 AACTTTCACAAATGAGAAGTAGG - Intergenic
923419266 1:233796600-233796622 CAGTTTCCACAATGAGAAATGGG + Intergenic
924386083 1:243498805-243498827 CATCTTCCAAAAAGAGAAGTGGG - Intronic
1067538311 10:47133547-47133569 AAGCTTCCCAAAGGAGATGTGGG + Intergenic
1070704200 10:78625705-78625727 CAGTTTCCCATCTGAGAAATGGG - Intergenic
1080082878 11:28241615-28241637 CAGTTTTCCAAAGGATAAATAGG + Intronic
1081941991 11:46951046-46951068 CAGTTTCCTCAAAGAAAAGTGGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1087643201 11:100777538-100777560 CTGTTTCCCAAATGAGAAATAGG + Intronic
1091259281 11:134221587-134221609 CACTTTCCCAAACTAAAATTAGG + Intronic
1096530715 12:52241250-52241272 CAGTGTCTCAAACGAGAATCTGG - Intronic
1097423629 12:59413759-59413781 CAATCTTCCAAACCAGAAGTTGG + Intergenic
1098628142 12:72698330-72698352 TAGTTTACCAAAAGAGCAGTAGG + Intergenic
1101296698 12:103431243-103431265 CAGTTTCCCAATCTAGAAAATGG - Intronic
1101482835 12:105118429-105118451 CAGTTCCTGAAACGAGAAGGTGG - Exonic
1107574673 13:41705467-41705489 CAGTTCACCAAAGGAGAATTGGG + Intronic
1108485939 13:50925002-50925024 GAGTTTCCAAAAGGAGAAGAGGG - Intronic
1108557160 13:51604991-51605013 CAGTTTCCTAGATGATAAGTGGG + Intronic
1111872748 13:93854266-93854288 GAGATTTCCAAACGAGAAATGGG - Intronic
1112749984 13:102572524-102572546 CAGTCACCAAAACGAAAAGTAGG - Intergenic
1116496424 14:45566136-45566158 CAGTTGCCTAATCCAGAAGTTGG + Intergenic
1118314052 14:64714855-64714877 CAGTGGCCAAAATGAGAAGTAGG + Intronic
1119183838 14:72622574-72622596 CAATTTCCCAAAGGAAAACTAGG + Intronic
1121909849 14:97779137-97779159 GTGTTTAGCAAACGAGAAGTGGG - Intergenic
1121951497 14:98174838-98174860 TAGTTTCATAAACGAGAATTAGG - Intergenic
1125184707 15:36916898-36916920 CAGTTTCCCCAACCAGAAAATGG - Intronic
1126453626 15:48837251-48837273 CAGTTTCCCAAATTAGCAGAAGG + Intronic
1128571137 15:68733818-68733840 CAGTTTTCTAACCGAGAAGAGGG + Intergenic
1129385465 15:75193822-75193844 CAGTTTCCTCATTGAGAAGTGGG - Intergenic
1131614569 15:94001597-94001619 CAGTTTCCCTTAGGAGAAGGAGG - Intergenic
1133961446 16:10497197-10497219 CACTTTCCCATACCAGAAGCAGG + Intergenic
1134249507 16:12564583-12564605 CAGTTTCACAAACAAGAAAAAGG - Intronic
1134302869 16:13007291-13007313 CAGTTTCCCAAACCAGAGATGGG + Intronic
1135998073 16:27268522-27268544 CAGTTTCCCCATCAAGAAGGGGG + Intronic
1139292883 16:65874099-65874121 CAGATTCCAAAATCAGAAGTGGG - Intergenic
1139448914 16:67014973-67014995 AAGTTTCTGAAACAAGAAGTGGG + Intergenic
1142436740 16:90064371-90064393 TAGTTTCCCGATCCAGAAGTTGG + Intronic
1142798622 17:2329292-2329314 CACTTTCCCAAAAGACAAGATGG + Intronic
1144497565 17:15758149-15758171 CAGTTCCCGAAGCCAGAAGTAGG - Intergenic
1148288006 17:46413531-46413553 CAGGTTCCTAAATGAGGAGTAGG - Intergenic
1148310176 17:46631115-46631137 CAGGTTCCTAAATGAGGAGTAGG - Intronic
1150583399 17:66495901-66495923 CAGTTTCCCAAAGTAGAAACCGG - Intronic
1151875548 17:76866193-76866215 CAGTTTCCTCAACTATAAGTGGG - Intergenic
1155955530 18:31953714-31953736 TAGTTTTGCAAACAAGAAGTAGG - Intergenic
1156899854 18:42288039-42288061 GAGTTTCCTAAAGGAAAAGTGGG - Intergenic
1159264874 18:66067908-66067930 CAGTTTCCCATAGGAAAACTGGG + Intergenic
1160389036 18:78516517-78516539 CAGATTCCCAAAAGAGAAGTGGG + Intergenic
1160476840 18:79198777-79198799 GAGTTTCCAGAACTAGAAGTTGG + Intronic
1160941977 19:1624497-1624519 CAGTTTGGAAAACGAGGAGTTGG + Intronic
1160946845 19:1647661-1647683 TTGTTTCCCAAATGAGAGGTTGG - Intronic
925766658 2:7242931-7242953 GAGGTTCCCAAACCAGATGTGGG - Intergenic
925882464 2:8364363-8364385 CAGATTCCCAAGTGAGAAATGGG - Intergenic
932929413 2:76016033-76016055 GAGTTTCCCAAAAGACAATTTGG + Intergenic
933983362 2:87571543-87571565 CAGTTTCCAAAAGAGGAAGTGGG + Intergenic
936079251 2:109421211-109421233 GAGTTTCCCAAATGAGAGGCAGG + Intronic
936310486 2:111379251-111379273 CAGTTTCCAAAAGAGGAAGTGGG - Intergenic
936554203 2:113478876-113478898 CAGTTTCCAAACTGAGAAGGAGG - Intronic
936922154 2:117699843-117699865 CAGTTTCCCAAAGGTAAAATGGG + Intergenic
943848123 2:192677815-192677837 CAATTTCTCAATCCAGAAGTTGG + Intergenic
945150342 2:206784057-206784079 CATTTCTCCAAAGGAGAAGTAGG + Intronic
945258451 2:207822262-207822284 CTGTTTTCCAAATAAGAAGTGGG - Intergenic
946366519 2:219252453-219252475 CAGATTCCCCACTGAGAAGTGGG - Intronic
948328747 2:237148755-237148777 GAGCTTCCCAAAGGAAAAGTAGG - Intergenic
1169190682 20:3657489-3657511 CAGTTTCCCAAAGGAAAAAAAGG - Intergenic
1169275995 20:4234107-4234129 CAGTTTCCCCAACAATATGTGGG - Intronic
1169797260 20:9476736-9476758 CAGTGTCCCAAACGCAAGGTAGG + Exonic
1172572423 20:35981081-35981103 TAGTTTCCCAAAGGAGAATCAGG + Intronic
1173612558 20:44380974-44380996 CAGTTTCCCAAACATGAATTTGG + Intronic
1174394943 20:50241578-50241600 CAGTTTCCCAAAGCAGTTGTAGG + Intergenic
1179132823 21:38653782-38653804 CACTGTCCCAAACAAGAGGTGGG - Intronic
1179292606 21:40031795-40031817 CTGTATCCCAAACCAGAAATGGG + Intronic
1183547246 22:38461029-38461051 CACTTTCCCCTTCGAGAAGTGGG - Intergenic
949278334 3:2315373-2315395 CAGTTTCCCAAACGAGAAGTGGG + Intronic
951461129 3:22952962-22952984 TAGTTTCCTAAAGGAGAATTGGG - Intergenic
954795976 3:53161504-53161526 CAGTTTCGGAAACGGGAACTGGG - Intronic
955855265 3:63266172-63266194 CATGTTCCCTAACTAGAAGTTGG + Intronic
956853960 3:73257698-73257720 CTGTCTCCCAAACTAGAAATTGG + Intergenic
957172660 3:76758644-76758666 CATTTTCCCAACAGAGAGGTGGG - Intronic
959632372 3:108521843-108521865 CAGTCTCCCAAAGGCCAAGTAGG - Intronic
962176114 3:133157189-133157211 CAGTTTTCCAAAAAAGATGTTGG + Intronic
963230895 3:142907785-142907807 CTGTTTCCCAAATTAGAAGGTGG + Intergenic
963248715 3:143085333-143085355 CAATTTCCCATACCAGAAGCAGG - Intergenic
963864376 3:150344421-150344443 TAGATGCCCAAACAAGAAGTTGG - Intergenic
964823914 3:160804911-160804933 CAATTTCCCAAACGTGAGGAAGG - Intronic
966553691 3:181233782-181233804 CAGTCTCCCAAACCAGAACTTGG - Intergenic
967759042 3:193203354-193203376 CATTTTCCAAAACAAGAATTTGG + Intergenic
976318735 4:83687121-83687143 AAGTTTCCCAAAAGAGAGGGAGG - Intergenic
978579277 4:110216405-110216427 CATTTCCCCAAAGGAGCAGTGGG - Intergenic
980643994 4:135618106-135618128 CAGTTACCCAAAAAAGAAATAGG - Intergenic
982247239 4:153365273-153365295 CAGTTCCCCAAAACAGAAGCAGG + Intronic
982600640 4:157444151-157444173 GAGTTTCTCAAGCCAGAAGTGGG + Intergenic
983514696 4:168643857-168643879 CAGTTTCCTAATCGGGAAGTAGG - Intronic
983574718 4:169248710-169248732 CAGTTTCCCAATCTGGAACTTGG + Intronic
993088157 5:83390320-83390342 CATTTTCACAAATGAGAAGTAGG + Intergenic
994219229 5:97175515-97175537 CATTTTCCCAAAAGGGTAGTAGG - Intronic
995661790 5:114492433-114492455 CTTTTTCCCAAAAGAGAAGTAGG - Intronic
997426182 5:133804239-133804261 CAGTGGCCCAAAGGAAAAGTTGG + Intergenic
1010190288 6:73188269-73188291 CAGTTTCCCAAAATATAAATAGG + Intronic
1012961860 6:105630543-105630565 TAGTGTCCCAAAGGAGAAGGAGG - Intergenic
1014607706 6:123498521-123498543 CATTTTCCCACAGGAGAGGTAGG + Intronic
1014927808 6:127295457-127295479 CAATATCCCAAAGGAGAAATGGG + Intronic
1016302961 6:142652358-142652380 CTGTTACCCAAACTAGAAGCTGG - Intergenic
1018481692 6:164197459-164197481 CAGTTTCCCAAATGTGGAGGAGG - Intergenic
1019892947 7:3961498-3961520 CAGTTTCCCTAAAGAGAAAGTGG - Intronic
1020354048 7:7257565-7257587 CAGTTTCCCAGGGGAGAGGTTGG - Intergenic
1021118312 7:16768706-16768728 CAGTTTTCAAAATGAGAAGGTGG + Intronic
1021159193 7:17250825-17250847 CAGTTTCCCAAGTGAGTAGCTGG + Intergenic
1023529905 7:41141859-41141881 CAGTGTCCCAAAAGAGAATATGG - Intergenic
1026258858 7:68736749-68736771 GAGTTTCTGAAAGGAGAAGTTGG - Intergenic
1027600038 7:80228607-80228629 CAGTTTCCAAAACCAGAATCAGG + Intergenic
1027853670 7:83482136-83482158 CTGTTTGCCAGAGGAGAAGTGGG + Intronic
1028844687 7:95466460-95466482 CATTTTCCCAAACTAGACTTAGG - Intergenic
1029318269 7:99734407-99734429 CAGCTTACCAAACCAGAATTTGG - Intronic
1032000765 7:128263723-128263745 TAGTTTCCCAAAGGAAAAGAGGG + Intergenic
1042205783 8:66328435-66328457 CACTTACCCTAAAGAGAAGTTGG - Intergenic
1042675756 8:71319892-71319914 CAAGTTCCCAAAAGAGAAGATGG + Intronic
1042999079 8:74735085-74735107 CAGTTTACCCAACTTGAAGTAGG + Intronic
1044275259 8:90291854-90291876 AAGTTTCCCAACCGAGAATGGGG - Intergenic
1047190448 8:122674473-122674495 CAGTTTCCTAAAGGAGGAGATGG - Intergenic
1047310961 8:123691592-123691614 CGGTTTCCCAAACGTAAAATAGG - Intronic
1048738910 8:137532383-137532405 CAGTTACAGAAAGGAGAAGTGGG - Intergenic
1049898800 9:138302-138324 CAGTTTCCAAACTGAGAAGGAGG + Intronic
1053283927 9:36838577-36838599 CAGTTTCCCACAAGGGAAGTTGG + Exonic
1053741853 9:41148614-41148636 CAGTTTCCAAACTGAGAAGGAGG + Intronic
1054347115 9:63978422-63978444 CAGTTTCCAAACTGAGAAGGAGG + Intergenic
1054444847 9:65304762-65304784 CAGTTTCCAAACTGAGAAGGAGG + Intergenic
1054485424 9:65716744-65716766 CAGTTTCCAAACTGAGAAGGAGG - Intronic
1054686490 9:68282686-68282708 CAGTTTCCAAACTGAGAAGGAGG - Intronic
1056230427 9:84538040-84538062 CAGTTTCCCAACTGTAAAGTTGG + Intergenic
1058880387 9:109280613-109280635 CAGTTTTCCCAAGGAGAGGTGGG - Intronic
1058886770 9:109327558-109327580 AAGTTTCCCAAAGGAGAAGGAGG - Intergenic
1060965074 9:127707635-127707657 CAGTTTCCCCAAATATAAGTGGG + Intronic
1060977394 9:127772799-127772821 CAGTTTCCCAATCTGTAAGTGGG + Intronic
1061586795 9:131574884-131574906 CAGTTTCCCCAGCTGGAAGTGGG - Intergenic
1185608620 X:1381083-1381105 CAGCTTCCAAAACGACAAGCTGG + Exonic
1186353256 X:8761939-8761961 CAGTTTCCCAAATATGAAGAGGG + Intergenic
1186620327 X:11234022-11234044 CAGTTTCCCAAATAAAAAGAGGG - Intronic
1186794478 X:13031103-13031125 CAGTTTCCCAAATATGAAGAGGG + Intergenic
1187789002 X:22927326-22927348 CAGTTTGGCTAATGAGAAGTTGG + Intergenic
1189949935 X:46218569-46218591 CAGATTGCCAAATGATAAGTAGG + Intergenic
1191083005 X:56533658-56533680 CAGTTTCTCCAACTATAAGTGGG - Intergenic
1195879221 X:109575255-109575277 CCATTTCACAAACGAGAAATAGG - Intergenic
1196463091 X:115949328-115949350 CACTTTCCCAAAGGTCAAGTAGG - Intergenic
1198074919 X:133185063-133185085 CAGTTTCCCCATCTATAAGTGGG - Intergenic
1198686771 X:139235778-139235800 CAGTTTCTCAAAAGAGAGGTGGG - Intergenic
1201952388 Y:19579794-19579816 CAGTGTCCCAAAGGAAAATTGGG - Intergenic