ID: 949285807

View in Genome Browser
Species Human (GRCh38)
Location 3:2402928-2402950
Sequence TTCCTGGAGCTGCCACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949285804_949285807 17 Left 949285804 3:2402888-2402910 CCTTGTGTATCTCATCTTTTGAA 0: 1
1: 2
2: 94
3: 763
4: 4908
Right 949285807 3:2402928-2402950 TTCCTGGAGCTGCCACAAACTGG 0: 1
1: 0
2: 5
3: 28
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949285807 Original CRISPR TTCCTGGAGCTGCCACAAAC TGG Intronic
900387298 1:2416501-2416523 GTCCTGGGTCTGCCACAGACGGG - Intergenic
900402370 1:2477853-2477875 TTCCTGGAGATGCCCCAGGCAGG + Intronic
900627902 1:3617864-3617886 TTGCTGGAGCTGCCAGAAGCTGG + Intergenic
901002794 1:6156918-6156940 ATCCTGGCTCTGCCACATACCGG + Intronic
904564832 1:31422617-31422639 TTCCTGGAGCTTACACAAGCAGG - Intronic
904770113 1:32876422-32876444 GGCCTGGAGCTGCCACTGACTGG - Intergenic
905398555 1:37684743-37684765 TTCCTGCAGATGCCTCCAACTGG - Intronic
906807379 1:48792382-48792404 TTCCTAGGGATGCCACAAACTGG - Intronic
908551599 1:65214054-65214076 TTGCTAGGGCTGCCACAGACTGG - Intronic
910533474 1:88268563-88268585 TTTCTGGTGCTGACACCAACTGG - Intergenic
914384919 1:147159255-147159277 TTCCTGCAGCGCCCCCAAACAGG + Exonic
915681844 1:157589125-157589147 TCCCTGGAGATTCCACGAACTGG - Intronic
916586734 1:166155922-166155944 GTCCAAGAGCTGCCAGAAACAGG - Intronic
917471203 1:175327464-175327486 TTCCTGTGACAGCCACAAACAGG - Intronic
918081880 1:181214125-181214147 TTCCTGGTGCTGGCACGAAATGG - Intergenic
918133956 1:181653607-181653629 TGCCTGGGGCTGCCAGAAGCTGG - Intronic
918190589 1:182170354-182170376 GTTCTGGAGCTGCCATAGACAGG - Intergenic
918960200 1:191265806-191265828 TTCAAGGAGCAACCACAAACAGG - Intergenic
920447498 1:206029874-206029896 GTCCTGGCTCTGCCACTAACTGG + Intergenic
920976717 1:210792563-210792585 TTACTGGAGTTGCCACTAGCTGG - Intronic
922797590 1:228348383-228348405 TTTCTGGAGTTGCCATAAAGGGG + Intronic
1063125220 10:3131034-3131056 ATAATGGAGCTGCCCCAAACAGG + Intronic
1069373375 10:67769751-67769773 TGGCTGGAAATGCCACAAACTGG - Intergenic
1069564352 10:69453170-69453192 TCCCTAGAGCTTCCACCAACAGG - Intronic
1069755273 10:70771001-70771023 CTCCTGGAGCTGAGACACACAGG - Intergenic
1070706318 10:78641721-78641743 TTCCTGCAGCTCCACCAAACTGG + Intergenic
1070719094 10:78744207-78744229 TTCCTGGAGCTGTCCCACACTGG - Intergenic
1070949395 10:80418807-80418829 TTCCAGGAGCTCCCACCCACAGG + Intronic
1071104489 10:82078847-82078869 TTCCTGTAGTAGCCACAAACAGG + Intronic
1071394358 10:85206933-85206955 TTCCTGAAGCTTCCACCCACTGG + Intergenic
1072381136 10:94871793-94871815 TTCATGGTGCTGCAAAAAACAGG - Intergenic
1073151060 10:101311710-101311732 TTCCAGGAGCTCCGACAAAGTGG - Intergenic
1073996244 10:109318299-109318321 TTCCTGGAGCAGACACAAATAGG + Intergenic
1074759761 10:116658327-116658349 TTCCTCGTGGTGCCACAGACTGG + Intergenic
1074852746 10:117451822-117451844 TTCCTGGATCTGTCACTGACTGG - Intergenic
1075106074 10:119541087-119541109 GTGCTGGAGCTGGCTCAAACTGG - Intronic
1075513550 10:123091765-123091787 TTCCTGGAGCTACCTAGAACAGG - Intergenic
1075568440 10:123521168-123521190 ATCCTAGAGCTGCCTCAAGCTGG - Intergenic
1076480794 10:130784056-130784078 TTATTTGAGCTGCCACAACCAGG + Intergenic
1076823962 10:132958017-132958039 CTCCTCAAGCTTCCACAAACAGG + Intergenic
1079328439 11:19514034-19514056 CTCCTGGGGCTGCCACAAACTGG - Intronic
1079732013 11:23945100-23945122 CCCCAGGAGCTGCCAGAAACTGG - Intergenic
1080821014 11:35806580-35806602 TTCCTTGACCTACCACAACCAGG - Exonic
1081300013 11:41439709-41439731 TTCCATGAGTTGCCACAAAGTGG - Intronic
1083893482 11:65608463-65608485 ATCCTGGAGCATCCACAATCTGG - Intronic
1084611419 11:70205532-70205554 TGCCTGGAGCCACCACAAAGCGG - Intronic
1085166690 11:74407397-74407419 CACCTGGAGCTACCAGAAACTGG - Intergenic
1087577640 11:100009928-100009950 TTCCTGGATATGCCACCAACCGG - Intronic
1088003022 11:104905462-104905484 TTCCTGGCGCTGCCACCTAGAGG - Intergenic
1091447723 12:553574-553596 TTCCTGGGGCTGTCACCAGCGGG - Exonic
1091904554 12:4173797-4173819 GTCCTGGCCCTGCCACTAACTGG - Intergenic
1092131249 12:6114746-6114768 TGCCTGGAGCTGCCTCACACAGG - Intronic
1096228836 12:49886256-49886278 TGCCTGGAGCTGCCCAACACAGG - Intronic
1096649703 12:53056029-53056051 TTCCTGGGGCAGCCACAAACAGG + Intronic
1097282743 12:57854817-57854839 TTCCTGTAGCAGCCATCAACTGG - Intergenic
1097637378 12:62139252-62139274 TTACTTGTGCTGTCACAAACAGG + Intronic
1098579737 12:72085252-72085274 TTCCTGGAACTTCCAAAATCGGG + Intronic
1098923829 12:76327690-76327712 CTCCTGGAGCTCCCAGAAGCTGG + Intergenic
1099432993 12:82610274-82610296 GTTCTGGAGCTGCCACTACCAGG - Intergenic
1102810366 12:115819126-115819148 TGCCTGGAGCCGCCAGAAGCTGG + Intergenic
1104187062 12:126442997-126443019 TTCCTGGACCTCCCACAGAAAGG + Intergenic
1105641339 13:22268214-22268236 TGCTTAGGGCTGCCACAAACTGG + Intergenic
1105825534 13:24119287-24119309 TTCCTGGGCCCACCACAAACTGG - Intronic
1107652482 13:42559332-42559354 TTCCAGGATCTGCCACTTACTGG - Intergenic
1107793223 13:44023662-44023684 CTCCTGGAGGTGCCATAAACAGG + Intergenic
1108570135 13:51741491-51741513 TCCCTGGAGCTGCCAGAAGTAGG + Intronic
1108889035 13:55229712-55229734 TTCCAGGAGTTGCCAAATACTGG + Intergenic
1110369103 13:74719922-74719944 TACATGGAGCTGCATCAAACTGG + Intergenic
1111930086 13:94503646-94503668 TTCCTGGAGCCACCAGAAGCTGG + Intergenic
1112248572 13:97756835-97756857 TTCCTAGAGCTGCCATTAAAAGG + Intergenic
1113188559 13:107717809-107717831 TTACTGAAGCAGCCACAATCAGG + Intronic
1115146542 14:30233266-30233288 TTCATTCAGCAGCCACAAACTGG + Intergenic
1115372783 14:32637362-32637384 TTCCTGAACCTGCTACAATCTGG - Intronic
1115745310 14:36430484-36430506 ATTCTGGATCTTCCACAAACTGG - Intergenic
1116396647 14:44454974-44454996 TTTCTGTAGCTGGCAAAAACTGG + Intergenic
1116466820 14:45243176-45243198 ATTCTGGTGCTGCCACAAATTGG + Intronic
1117785401 14:59279019-59279041 TTCCTGGGGCTCCAACAAGCAGG + Intronic
1119008890 14:70962278-70962300 TTTCTGGAACTGCAACCAACTGG - Exonic
1119165575 14:72489678-72489700 TGCCTGGAGCCACCAGAAACTGG + Intronic
1119893407 14:78200031-78200053 TGCCAGGAGCTGTCACAATCTGG - Intergenic
1120985581 14:90331843-90331865 TTCCTGGAGCTCCCGCCATCGGG + Exonic
1121996759 14:98608671-98608693 TTCCTGGAGCCTCCATAATCTGG - Intergenic
1122906921 14:104805851-104805873 GTCCTGGATTTGCCACCAACTGG - Intergenic
1127370731 15:58337195-58337217 TTCCTGGTGTTCCCATAAACTGG + Intronic
1127715570 15:61645881-61645903 CTCCTGGAGCTACCAGAAGCTGG + Intergenic
1128773073 15:70297370-70297392 TTCCTGGACCTGCTGCACACAGG + Intergenic
1128877336 15:71213172-71213194 TTCCTGGAGCCACCAGAAGCTGG - Intronic
1129980267 15:79863000-79863022 GTCCTGGAGCCACCTCAAACGGG + Intronic
1130678253 15:85973535-85973557 TCCCTGGGGCTGCCAGAAACTGG + Intergenic
1130876265 15:88017421-88017443 TTCCTGGAGCTGCCACTCTGGGG - Intronic
1130891024 15:88133974-88133996 TTCCTGGAGCTGCCACACCCTGG + Intronic
1132003482 15:98203868-98203890 GTTCTGGAGCACCCACAAACTGG - Intergenic
1133832639 16:9338306-9338328 CTGCTGGAGCAGCCACAATCTGG - Intergenic
1134455823 16:14394461-14394483 GTCCTGGATCTGGCACACACAGG + Intergenic
1137393613 16:48101509-48101531 CTCCTGGAGCTTCCACATAAAGG - Intronic
1140218740 16:73028455-73028477 ATGCTGGGGCTGCCACACACCGG + Intronic
1140455137 16:75100542-75100564 CTCCTGGAGCTGACACAGATGGG + Intronic
1140872071 16:79115496-79115518 TTTTAGCAGCTGCCACAAACTGG + Intronic
1141637306 16:85321100-85321122 TGCCTGGAGGTGTCACAGACTGG - Intergenic
1141768406 16:86073742-86073764 TTCTTGGCGCTACCACTAACTGG + Intergenic
1142386624 16:89769325-89769347 TCCCTGCAGCTGCCACGCACAGG - Intronic
1142542430 17:670735-670757 TTCCTGCAGTGGCCACAAAGGGG - Intronic
1143944010 17:10573427-10573449 AACCTAGAGCTGCCACGAACTGG - Intergenic
1145968562 17:28939765-28939787 ATGCTTGTGCTGCCACAAACAGG + Intronic
1145994297 17:29096705-29096727 CTTCTGGAGCAGCCACAGACAGG - Intronic
1146763070 17:35495509-35495531 GTCCTGGAGATGCCACAAACTGG - Intronic
1147669712 17:42169922-42169944 GCCCTGGGGATGCCACAAACAGG - Intronic
1150533895 17:66014724-66014746 TGCATGGGGCTGCCACACACTGG - Intronic
1150807032 17:68327439-68327461 TGCCTGGAGCTACCAAAAGCTGG - Intronic
1152565806 17:81099850-81099872 TCCGTGGGGCTGCCCCAAACCGG + Intronic
1152635726 17:81429818-81429840 TTCCTGGGGCTACCCCAACCTGG - Intronic
1152743235 17:82027685-82027707 TTCCTGAAGCTGCCCTACACGGG - Exonic
1152979784 18:266268-266290 TTCCTTGCTCTGCCACTAACAGG + Intronic
1153904579 18:9649931-9649953 GGCCTGTAGCTGACACAAACTGG + Intergenic
1155631949 18:27904880-27904902 CTGCTGGAGCTGCCATAAGCTGG - Intergenic
1158218967 18:55130041-55130063 TGCCTGGGGCTGCCAAAAACTGG + Intergenic
1160313877 18:77822204-77822226 TCACTGAAGCTGCCACAGACGGG - Intergenic
1161431398 19:4234375-4234397 TGCCTGGGGCTGCCACAGAGGGG - Intronic
1164305987 19:24004073-24004095 TTCCTGTGGCTGCCACAGTCCGG - Intergenic
1164400940 19:27901793-27901815 TTCCTGGAGCTACCATGAGCAGG + Intergenic
1164466303 19:28490237-28490259 GCCCTGGGGCTGCCACAAAAAGG + Intergenic
1165139481 19:33690164-33690186 TTCATGGAACTGCCCCTAACAGG - Intronic
1166625201 19:44345391-44345413 TTCTTGGAGCTGTCACTAAGAGG + Intronic
1167715121 19:51138111-51138133 ATCCTGGAGCTGCCCCAGAAAGG + Intergenic
1167772443 19:51529807-51529829 GTCCTGGAGCTGCCTCAAGTAGG - Exonic
925542458 2:4980383-4980405 TTCCAGGAGCTGCAGCAAAGGGG + Intergenic
926684362 2:15687426-15687448 TGCCTGGAGCCACCAGAAACCGG - Intergenic
926945117 2:18178937-18178959 TTCATGGAGCTGCCACTAGAGGG - Intronic
926999067 2:18773280-18773302 TTTTTGGAGATGCCACAAAGTGG + Intergenic
928759874 2:34569820-34569842 CACCTGGAGCTACCAGAAACTGG + Intergenic
929231816 2:39567929-39567951 TTCCTTGAGCTCCCAGAAGCTGG - Intergenic
929863841 2:45701070-45701092 TTCCTAGGGCTGCCACAAAAAGG - Intronic
930408089 2:50987844-50987866 TTTCTGCAGCTGCTACAAACTGG - Intronic
931137636 2:59421919-59421941 TTCCTGGAATTGCCACAGACAGG - Intergenic
931577079 2:63729505-63729527 GTCCTGGCCCTGCCACTAACTGG - Intronic
932810657 2:74823014-74823036 CTGCTGGAGCTGCCAGAAACAGG + Intergenic
933688060 2:85158845-85158867 CTCCTGGTACTGCCACAAGCTGG + Intronic
933981857 2:87556839-87556861 TTCCTGGTGGTTCCAAAAACTGG - Intergenic
936311981 2:111393978-111394000 TTCCTGGTGGTTCCAAAAACTGG + Intergenic
936629255 2:114183289-114183311 TGCCTGGAGCTACCAGAAACTGG - Intergenic
937195015 2:120146268-120146290 TTCAGGATGCTGCCACAAACAGG + Exonic
942611654 2:177747921-177747943 ATCCTGGCTCTGCCACCAACAGG - Intronic
946739002 2:222783533-222783555 TTTCTGGACCTGCCAAAAATGGG + Intergenic
946962981 2:225004354-225004376 TTCTTGGAGCCACCAGAAACTGG + Intronic
947370791 2:229443392-229443414 AACTTGGAGCTGCTACAAACAGG - Intronic
947635344 2:231677903-231677925 TCCCAGGACCTGGCACAAACGGG - Intergenic
949022296 2:241748524-241748546 CTCCTGGATCTGCCCCAATCAGG + Intronic
1168861858 20:1051520-1051542 TTCCTGGAGCAGGTAGAAACGGG - Intergenic
1172274846 20:33673913-33673935 AGCCTGGAGCTGCCACAGAGTGG + Intronic
1173076684 20:39825927-39825949 TTCTTGGAGCTTCCACACAAAGG + Intergenic
1174321821 20:49748018-49748040 GTCTAGGAGCTGCCAAAAACAGG + Intergenic
1176880549 21:14187195-14187217 TTCCTGGAGCTGAGACTAAGAGG - Intronic
1177675695 21:24295591-24295613 TTCCTGGATCCTCCAAAAACTGG + Intergenic
1178434915 21:32549596-32549618 TTTCTGGCTCTGCCACATACTGG + Intergenic
1180096281 21:45556676-45556698 TGGCCGGAGCTGCCACAGACAGG + Intergenic
1182034496 22:27187017-27187039 TTCTTGGAGCTGCCCCACAGAGG + Intergenic
1183044815 22:35211202-35211224 TCACTGGGGCTGACACAAACAGG - Intergenic
1184130022 22:42512123-42512145 TGCCTGGGACTTCCACAAACTGG - Exonic
1184140201 22:42573941-42573963 TGCCTGGGACTTCCACAAACTGG - Exonic
1184615272 22:45633768-45633790 TTCCTGCTTCTGCCACATACTGG + Intergenic
949285807 3:2402928-2402950 TTCCTGGAGCTGCCACAAACTGG + Intronic
950794678 3:15501299-15501321 TCCCTGCTGCTGCCACACACAGG + Intronic
951098230 3:18656382-18656404 TTCCAGGAGCTTCTAAAAACCGG - Intergenic
952141712 3:30486546-30486568 TTCTTGGAACTGCTACAAAGTGG + Intergenic
953352027 3:42222961-42222983 TGGCTGGTGCTGCCACAAGCTGG - Exonic
954674109 3:52306301-52306323 TTCATGGAGCCTCCACAATCTGG - Intergenic
955733763 3:62015273-62015295 TTCCTGCCTCTGCCTCAAACAGG - Intronic
955776581 3:62440268-62440290 TTACTGGATCTCCCACAAATTGG + Intronic
955935073 3:64095231-64095253 TTCCTCGAGCCTCCACAACCTGG + Exonic
955962184 3:64351962-64351984 GTCCTGGTGCTGTCACAAACTGG - Intronic
958262650 3:91400793-91400815 ATACTGGAGCTAACACAAACTGG + Intergenic
960187216 3:114658652-114658674 TTCATGGAGCAGCCATAAAATGG + Intronic
961643779 3:128381637-128381659 TTCCTGGAGCTTCCACAGAAGGG + Intronic
964444436 3:156744007-156744029 TGCCCAGAGCTGCCACACACAGG - Intergenic
964927956 3:161979515-161979537 TCCATGGAGCTGACAGAAACTGG - Intergenic
965741291 3:171877333-171877355 TTGCAGGAGCTTCTACAAACAGG - Intronic
965755606 3:172023340-172023362 TTCCTTGACCTGCCAGAAAGTGG + Intergenic
966013085 3:175105972-175105994 TTCCTGAAGCTGAAACTAACAGG - Intronic
966417800 3:179707404-179707426 CTCCTGGAGCAGCCCTAAACCGG + Intronic
966851155 3:184165862-184165884 TTCCTGGCTCTGCCACTTACTGG + Intronic
967813872 3:193782840-193782862 TTCCTGCAGCTTTCACACACTGG + Intergenic
967838440 3:193984040-193984062 TGCCTGGGGCTGCCAGAAGCTGG + Intergenic
968751304 4:2390514-2390536 TTCCTGAAGCTGACAGAAGCTGG + Intronic
973896840 4:55422048-55422070 TTCCTGGTGAGGCCAGAAACTGG - Intronic
975240863 4:72057430-72057452 TTCCTGGAGCCACCACAAGCTGG - Intronic
978911595 4:114070134-114070156 TTCCAGGAGCCACCAGAAACTGG + Intergenic
979169621 4:117584373-117584395 TTCTGAGAGCTGCCAAAAACTGG + Intergenic
980400964 4:132285181-132285203 CTCCTGGAGCTGCAACCAGCAGG + Intergenic
981294488 4:143115531-143115553 TGCCAGGAGCTGCCAGAAAGTGG + Intergenic
982361791 4:154526314-154526336 TTCCTGGAGCTGCGAGGAAAGGG + Intergenic
982659295 4:158187816-158187838 TTCCTGGAAGTACCACAAACTGG - Intergenic
984085409 4:175304133-175304155 TTCTTGTTGTTGCCACAAACTGG - Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
985585485 5:731004-731026 TTGCTAGAGCTTCCACAAGCAGG - Intronic
985599000 5:815325-815347 TTGCTAGAGCTTCCACAAGCAGG - Intronic
985599923 5:822431-822453 TTGCTAGAGCTTCCACAAGCAGG - Intronic
986209015 5:5652697-5652719 TTTCTGGAGCTGCCAGAAACTGG + Intergenic
986671153 5:10144158-10144180 TACCAGGAGCTACCAGAAACTGG - Intergenic
986698377 5:10378398-10378420 ATCCTGGTTCTGCCACTAACTGG - Intronic
987447856 5:18043514-18043536 TTCCTGAATCAACCACAAACAGG + Intergenic
989863584 5:46417185-46417207 TACCTGCAGATGCCACAAAAAGG + Intergenic
991356084 5:65769946-65769968 TTTCTGGATCTGCCACTAACTGG - Intronic
992995764 5:82331260-82331282 TTCCTGGCTCTGCCCCAAGCTGG + Intronic
995275873 5:110277291-110277313 CTCATGGATCTGCCACCAACAGG + Intergenic
995625599 5:114072718-114072740 ATCCTGGATCTACCACTAACTGG + Intergenic
996346507 5:122493633-122493655 TTCCTGGCGCTGCCACCACATGG + Intergenic
999345058 5:150810604-150810626 GTCCTGGATCTGCCACTTACTGG - Intergenic
1001247622 5:170116901-170116923 GTCCTGGAGCTTGCTCAAACTGG - Intergenic
1001985385 5:176070208-176070230 TTTCTGCAGATGACACAAACTGG - Intronic
1002231485 5:177767912-177767934 TTTCTGCAGATGACACAAACTGG + Intronic
1002605227 5:180379114-180379136 CACCTGGAGCTGCCAGAAACTGG - Intergenic
1003138090 6:3448437-3448459 GTCCTGAGGTTGCCACAAACTGG - Intronic
1003143534 6:3491349-3491371 TGCCAGGAGCTACCACAAACTGG - Intergenic
1005155813 6:22804858-22804880 TTCCTGGAGCCACCAGAAGCTGG + Intergenic
1006116014 6:31776577-31776599 TTCCTGGAGCAGCCACCCCCAGG - Exonic
1007325207 6:41054211-41054233 TTCCTGGAGATGGCATAATCTGG - Intronic
1008992767 6:57622094-57622116 ATACTGGAGCTAACACAAACTGG - Intronic
1009181389 6:60521204-60521226 ATACTGGAGCTAACACAAACTGG - Intergenic
1010296801 6:74207855-74207877 TTCCTAGAAGTGCCACAAAGGGG - Intergenic
1011591651 6:88975743-88975765 TTCCTGGGGCAACCAGAAACTGG - Intergenic
1015841024 6:137477419-137477441 TACCTGGGGCCACCACAAACTGG + Intergenic
1016397515 6:143641356-143641378 TGCCTGGAGCTTCCAGAAGCTGG + Intronic
1017278956 6:152602928-152602950 TTCCTTGAAATGCCACAAAAGGG - Intronic
1017864914 6:158434958-158434980 TTCTTGGAGCTCCCCCAGACTGG - Intronic
1018302562 6:162418949-162418971 ACCCTGGAGGTGTCACAAACTGG + Intronic
1019104934 6:169660230-169660252 TTTCTGGAGCTGGCAGAAACTGG + Intronic
1020838813 7:13188461-13188483 TTCCTGTGGCGGCCACAAAGGGG + Intergenic
1021012570 7:15489532-15489554 TTTATGGAGCTCCCACTAACAGG + Intronic
1022478130 7:30725255-30725277 TGCCAGGAGCTGCCAGAACCTGG + Intronic
1023915867 7:44588826-44588848 TGCCTGGAGCCACCAGAAACTGG + Intergenic
1026213728 7:68329663-68329685 TTCCTGGAGCTGCCCTGAAGTGG + Intergenic
1029552391 7:101244376-101244398 TGCCTGGAGCTGCCACCAGGTGG - Intronic
1029639645 7:101812563-101812585 TTCTTGGAGCTGCCAAAAGAGGG + Intergenic
1029936477 7:104430308-104430330 TTCCTGCAGATGCTACAAACAGG - Intronic
1031079827 7:117247522-117247544 TGCCTGGAGCCACCAGAAACTGG - Intergenic
1033936623 7:146593352-146593374 TTCCTGGAGCTCCCACTAAGGGG + Intronic
1038015364 8:23510105-23510127 CTCCTGGAGCTGGGACACACAGG - Intergenic
1038513914 8:28167636-28167658 CTCGTGTAGGTGCCACAAACTGG - Intronic
1038738090 8:30190647-30190669 TTCCAGGAGCTGCCAAACAGTGG + Intergenic
1039686073 8:39802618-39802640 TTACTGGAGCCCCTACAAACTGG + Intronic
1041089192 8:54286290-54286312 CTCCTGGACCTGGCACACACTGG + Intergenic
1041709156 8:60877039-60877061 TTGCTGGGGCTGCCATAACCAGG - Intergenic
1045819359 8:106317681-106317703 ATCCTCAAGCTGCCAGAAACAGG - Intronic
1046773936 8:118144038-118144060 TGCCTGGAGCTACCAGAAGCTGG - Intergenic
1048949684 8:139485601-139485623 TGCTTGGAGCTGCCAGAAACTGG - Intergenic
1050661394 9:7886712-7886734 ATCCTGGGTCTGCCACACACTGG + Intronic
1053378885 9:37632633-37632655 TTGCAGGAGCTGTCACAAAAAGG - Intronic
1055644958 9:78354780-78354802 TTCCTGAAGCTTGCACAAACAGG + Intergenic
1056205564 9:84316386-84316408 TTCCCCGAGCTGCCCCCAACAGG - Intronic
1058326122 9:103700106-103700128 TTCCTGATTCTGCCACAAAAGGG - Intergenic
1058485862 9:105442882-105442904 TTCCTGTAGCTTCCACCAATTGG + Intergenic
1058959685 9:109980736-109980758 GGGCTGGAGCTGCCACATACAGG + Intronic
1059942939 9:119375585-119375607 TTCCTTGAGCTTCGGCAAACAGG - Intergenic
1060834507 9:126745010-126745032 TTCCTGTCGCCTCCACAAACAGG - Intergenic
1061247942 9:129410826-129410848 CACCTAGAGCTGCCAGAAACTGG - Intergenic
1061481213 9:130898575-130898597 TTCCAGGAGCTGCCTCAGGCTGG + Intergenic
1188782023 X:34297133-34297155 TTCCTGTGGCTGCACCAAACTGG - Intergenic
1189000741 X:36941854-36941876 TTCTTGGAGCTGCCAGATAGAGG - Intergenic
1190337716 X:49272353-49272375 ATCCTGGCGCTGCCACTTACTGG + Intronic
1195733726 X:107991997-107992019 CACCTGCAGTTGCCACAAACTGG - Intergenic
1200074061 X:153542610-153542632 TGGCTGGAGCTGCCACCATCAGG - Intronic
1200074319 X:153543683-153543705 TGGCTGGAGCTGCCACCATCAGG + Intronic