ID: 949289790

View in Genome Browser
Species Human (GRCh38)
Location 3:2450851-2450873
Sequence AGGACAGGGTCTGCCTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949289790_949289793 -7 Left 949289790 3:2450851-2450873 CCTGAAAAGGCAGACCCTGTCCT 0: 1
1: 0
2: 3
3: 13
4: 197
Right 949289793 3:2450867-2450889 CTGTCCTCTCTGCTTACCATAGG 0: 1
1: 0
2: 2
3: 34
4: 228
949289790_949289795 -3 Left 949289790 3:2450851-2450873 CCTGAAAAGGCAGACCCTGTCCT 0: 1
1: 0
2: 3
3: 13
4: 197
Right 949289795 3:2450871-2450893 CCTCTCTGCTTACCATAGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949289790 Original CRISPR AGGACAGGGTCTGCCTTTTC AGG (reversed) Intronic
900458100 1:2787028-2787050 AGGTAAGGGTCTGCCTTTCCTGG + Intronic
903142757 1:21349137-21349159 AGACCAGGGGCTGCGTTTTCTGG - Intergenic
903280148 1:22245651-22245673 GGTCCAGGCTCTGCCTTTTCAGG + Intergenic
903318476 1:22527109-22527131 TAGACAGTGTCTGCCTTTCCAGG + Exonic
903973793 1:27136472-27136494 CTGGCAGGGTCTGACTTTTCTGG - Intronic
904418371 1:30376188-30376210 AGGACAGTGTTTGCATTTTGAGG - Intergenic
904460944 1:30679528-30679550 AGGACAGGGGCTGCCTTCCTGGG - Intergenic
904598393 1:31660828-31660850 AGGCCAGGCCCTGCCTTTTTAGG + Intronic
906497645 1:46316863-46316885 AGGACAGGGTCTTACTTTGTTGG + Intergenic
907811429 1:57874473-57874495 AGGACAGGCACTGCCCTTCCTGG - Intronic
908771287 1:67599231-67599253 AGGACAGAGCCTGGCATTTCTGG + Intergenic
909373300 1:74912719-74912741 AGGACAGGGTCTCATTTTTATGG + Intergenic
913139292 1:115924595-115924617 AGGAAATGGTCTCTCTTTTCTGG - Intergenic
916100647 1:161390484-161390506 AGGAGATGGGCTGCCTTCTCTGG + Intergenic
917923610 1:179771054-179771076 CTGACAGGGCCTGCTTTTTCCGG + Intronic
918174928 1:182035345-182035367 AGGAAAGGGTGTGCTTTTTCCGG + Intergenic
918756047 1:188340315-188340337 AGTACAGGGTTTGCCTCCTCAGG + Intergenic
920345731 1:205304552-205304574 GGGACAGGGAGTGCCTATTCTGG - Intronic
920506488 1:206518751-206518773 AGGACATGGTCTGCCTGTTTTGG + Intronic
921064343 1:211612054-211612076 AGGCCATGGTGTGGCTTTTCTGG - Intergenic
923266535 1:232319785-232319807 CAGACAGGGTATGCCCTTTCTGG - Intergenic
1064380450 10:14837707-14837729 GGGACAGGGCCTGCATTTCCTGG + Intronic
1071243567 10:83738053-83738075 GAGACAGGGTCTCCCTTTTCAGG - Intergenic
1074467192 10:113694017-113694039 AGCACAAGGTCTGCCTTTGCAGG - Intronic
1075105375 10:119536761-119536783 ATGACAGGGTCTTTGTTTTCGGG - Intronic
1075458525 10:122600536-122600558 AGCACAAACTCTGCCTTTTCTGG - Intronic
1077293885 11:1815072-1815094 ATGACACGGTCTTCCTTCTCGGG - Intergenic
1077994699 11:7443147-7443169 AGGCCAGGGGATTCCTTTTCAGG - Intronic
1080389793 11:31834399-31834421 ACCACAGGGCCTGCCTTCTCTGG - Intronic
1081552999 11:44131439-44131461 AGGTAAGGATCTGCCTTCTCTGG + Intronic
1082201116 11:49368917-49368939 AGGACAAGCTATGACTTTTCTGG - Intergenic
1082911174 11:58376050-58376072 AGGTCAGGGACTGACTTTCCAGG - Intergenic
1084723507 11:70924874-70924896 AGCACAGGGTCTGCCACTCCCGG + Intronic
1085147349 11:74213108-74213130 AGGCCTGGGACTGCCTCTTCAGG - Intronic
1085259786 11:75197913-75197935 GGGACAATGTCTGCCTTCTCAGG + Intronic
1086962010 11:92987506-92987528 AAGGGAGGGTCTGCCTTTCCTGG + Intergenic
1092287646 12:7138136-7138158 TGGGCAGGGTCAGCATTTTCTGG + Intronic
1093503957 12:19843245-19843267 AGAACAGGGTCTTTGTTTTCAGG - Intergenic
1095659255 12:44710022-44710044 AAGACATGGTCTGCCTTTCGAGG - Intronic
1096520852 12:52183816-52183838 AGGACAAGCCCTGCCCTTTCAGG + Intronic
1096532767 12:52252347-52252369 AGGACATGGCCTGCCTGATCAGG - Intronic
1096537923 12:52287188-52287210 AGGACATGGCCTGCCTGATCAGG - Exonic
1096540848 12:52306172-52306194 AGGACATGGCCTGCCTGATCAGG + Exonic
1098307962 12:69120266-69120288 CTGACAGCGTCTGCCTTTTTGGG - Intergenic
1101319939 12:103664545-103664567 AGGTCTGGGTCTTTCTTTTCAGG + Intronic
1102674586 12:114648611-114648633 AGTACAGAGTCTGCCTTTGAGGG - Intergenic
1103006020 12:117420960-117420982 AAGACAGGGTATGCATTTCCTGG - Intronic
1103141369 12:118551626-118551648 AGGACAGTGTTTGCCTCTTGTGG + Intergenic
1103981497 12:124739715-124739737 GGCACAGGCTCTGCCCTTTCAGG - Intergenic
1104122005 12:125808690-125808712 AGGGGAGCGTCTGCCTCTTCAGG - Intergenic
1104437406 12:128766898-128766920 AGCACAGTGTCCCCCTTTTCTGG - Intergenic
1105990850 13:25619173-25619195 AGGACAGGGTCTACAGTTTAGGG + Intronic
1106640027 13:31574316-31574338 AGTACAGGGTCTATCTTTTGTGG - Intergenic
1108173149 13:47764610-47764632 AGGCCAGGGTATGCATTTTTGGG - Intergenic
1108461851 13:50674855-50674877 AGGACAACGTGAGCCTTTTCTGG - Intronic
1111204375 13:84985271-84985293 AGGTAAGTGGCTGCCTTTTCTGG + Intergenic
1111763153 13:92492020-92492042 GGGACAGAGTCTGCCTTTTGGGG - Intronic
1113481271 13:110623519-110623541 AGGACGGGGTCTGCCCACTCTGG + Intronic
1113937205 13:114000752-114000774 GGGACTGAGTCTGCTTTTTCAGG - Intronic
1114061907 14:19026191-19026213 AGGACAAGGTCTCTCTTTCCAGG + Intergenic
1115309905 14:31968634-31968656 GAGACAGGATCTGCCTTTGCAGG + Intergenic
1115360426 14:32494227-32494249 AGGACAGAGTCTGGATTTCCAGG - Intronic
1120127435 14:80762620-80762642 ATGAAAGGGTCTGTCTTTCCTGG - Intronic
1122396891 14:101439984-101440006 AGGGCAGGCTCTGCCATTTCTGG - Intergenic
1122839681 14:104451165-104451187 AGGACGGGGTTTGCCTTGGCCGG - Intergenic
1126544411 15:49857073-49857095 AGGGCAGGGCCTGGCTCTTCAGG - Intergenic
1127067805 15:55258437-55258459 TGGACAGGGCCTGGCCTTTCTGG - Intronic
1128300151 15:66561617-66561639 GGGACAGAGTCTGCCTTCTTCGG + Intronic
1128902103 15:71433633-71433655 AGGGCAGGGCCTGTCTGTTCTGG + Intronic
1130558279 15:84938766-84938788 AGGGCAGGGTCTTCCTTGGCTGG + Intronic
1131525990 15:93153097-93153119 AGGACAGGCTGTTCCTTTCCAGG - Intergenic
1132043966 15:98548643-98548665 AGGACGGAGGATGCCTTTTCTGG - Intergenic
1135778356 16:25276762-25276784 AGGACAGCGTTTGCTTCTTCAGG + Intergenic
1136997679 16:35201934-35201956 AGGAGAGTGTCTTCCTCTTCCGG + Intergenic
1140808030 16:78551731-78551753 AAGACAAAGTCTGCTTTTTCAGG - Intronic
1142036373 16:87864476-87864498 AGGGCAGGGTCTCCCTTCCCGGG + Intronic
1142617018 17:1142671-1142693 AGGACAAGCCCTGCCTCTTCCGG - Intronic
1143204628 17:5133296-5133318 GGGACAGGGTCTCCCTTCCCAGG - Intronic
1144875690 17:18395981-18396003 GGGACAGGGTCTCCCTTCCCAGG - Intergenic
1145156536 17:20548440-20548462 GGGACAGGGTCTCCCTTCCCAGG + Intergenic
1145760343 17:27421994-27422016 GGGACAGGGTCTCCCTTCGCAGG - Intergenic
1146160367 17:30556288-30556310 GGGACAGGGTCTCCCTTCCCAGG - Intergenic
1146844034 17:36172526-36172548 GGGACAGGGTCTCCCTTCCCAGG + Intronic
1146856337 17:36260461-36260483 GGGACAGGGTCTCCCTTCCCAGG + Intronic
1146864279 17:36327914-36327936 GGGACAGGGTCTCCCTTCCCAGG - Intronic
1146872247 17:36384372-36384394 GGGACAGGGTCTCCCTTCCCAGG + Intronic
1146879608 17:36435457-36435479 GGGACAGGGTCTCCCTTCCCAGG + Intronic
1147067138 17:37928502-37928524 GGGACAGGGTCTCCCTTCCCAGG - Intronic
1147075133 17:37984996-37985018 GGGACAGGGTCTCCCTTCCCAGG + Intronic
1147078670 17:38008063-38008085 GGGACAGGGTCTCCCTTCCCAGG - Intronic
1147086658 17:38064542-38064564 GGGACAGGGTCTCCCTTCCCAGG + Intronic
1147094608 17:38131998-38132020 GGGACAGGGTCTCCCTTCCCAGG - Intergenic
1147102601 17:38188505-38188527 GGGACAGGGTCTCCCTTCCCAGG + Intergenic
1149092073 17:52795502-52795524 AGGCCTGGGGCTGCCTTTTCAGG - Intergenic
1149847176 17:60014972-60014994 GGGACAGGGTCTCCCTTCCCAGG + Intergenic
1150085535 17:62271589-62271611 GGGACAGGGTCTCCCTTCCCAGG + Intergenic
1150716508 17:67576779-67576801 AAGACAGGGGCTGCCTTTTCTGG + Intronic
1150845877 17:68657430-68657452 AGAACATGGTGTGGCTTTTCTGG + Intergenic
1152474508 17:80509253-80509275 AAGACAGGGGCTGCCTTTTCTGG + Intergenic
1153471964 18:5456887-5456909 AAGACAGGGCCTGCCGTGTCTGG - Intronic
1153642139 18:7166290-7166312 AGGACAGGGTCTCCCAGCTCAGG - Intergenic
1155533526 18:26791984-26792006 ATGACAGAGTGTGACTTTTCAGG - Intergenic
1157319531 18:46623695-46623717 CTGCCAGTGTCTGCCTTTTCTGG - Intronic
1158572862 18:58611706-58611728 AGCACAGCGTCTGACTTCTCAGG + Exonic
1163087261 19:14991154-14991176 AGGATAGGATTTGCCTATTCTGG - Intronic
1163184906 19:15630912-15630934 AGGACAGGGACTGCTATTTAGGG + Intronic
1163388263 19:17013675-17013697 GGGACAGGGTCTTCTTTTGCGGG + Intronic
1164606188 19:29599918-29599940 AGGAAAAGGGGTGCCTTTTCTGG - Intergenic
1164645874 19:29858503-29858525 AGCACAGGGTCTGGATTCTCTGG - Intergenic
1165161138 19:33817138-33817160 AGGCCAGCGGCTGCCTTCTCTGG - Intergenic
1165290771 19:34883575-34883597 AGCTAAGGGTCTGTCTTTTCAGG - Intergenic
1166504052 19:43360589-43360611 ATGACAGTGTCTGCCTTTCTGGG + Intronic
1166506405 19:43374169-43374191 ATGACAGTGTCTGCCTTTCTGGG - Intergenic
1168412034 19:56146334-56146356 AGGAAAGGGTGTGCCCTTCCTGG - Exonic
925031010 2:649829-649851 AGGACACGCTCTGCCTTCGCTGG + Intergenic
928777609 2:34784775-34784797 ATGACAGGAACTGCCTTTGCTGG - Intergenic
929096138 2:38264887-38264909 AGGACAGGCTCTGCTTTGTGAGG + Intergenic
930057819 2:47265456-47265478 AGGTCAAGGTTGGCCTTTTCTGG + Intergenic
934561944 2:95318023-95318045 AGGATTGGGCCTGCCTTATCTGG + Intronic
937285522 2:120748489-120748511 TGGACAGGGTGTGGCATTTCTGG + Intronic
937820208 2:126302242-126302264 AGGGCAGGGCCAGCCTCTTCAGG - Intergenic
938992069 2:136639888-136639910 AGGACAGGGCCTCCTTTCTCAGG - Intergenic
948259968 2:236596483-236596505 ACGGCAGGGTCTGCCTCTCCAGG - Intergenic
948390053 2:237605494-237605516 ATGACAAGGTCAGCCTTTTGTGG + Intergenic
1169122859 20:3107739-3107761 AGGACAGGGCCTGCCACTCCAGG + Exonic
1169503439 20:6183741-6183763 AGCTCTGGGTTTGCCTTTTCTGG + Intergenic
1170339400 20:15306579-15306601 AGCACAGGGTCTGTTTTCTCAGG + Intronic
1170480939 20:16764313-16764335 CGGACAGGATCTGCCTATTAAGG - Intronic
1172025513 20:31945705-31945727 AGGACAGGATCTGCCCTGTAAGG - Exonic
1172049086 20:32102627-32102649 GAGACAGGGTCTTGCTTTTCTGG - Intergenic
1172914740 20:38435101-38435123 AGGACAGGGCCTGACCTCTCTGG + Intergenic
1173582581 20:44158011-44158033 AGAACAGTATCTACCTTTTCAGG + Intronic
1173943675 20:46933209-46933231 AGCACCTAGTCTGCCTTTTCTGG - Intronic
1174824178 20:53754519-53754541 AGGGCAGGAGCTGCCTTTTTGGG + Intergenic
1177351900 21:19953806-19953828 AGGACATGATCTTCCTTTTATGG - Intergenic
1179218459 21:39386564-39386586 AGGACAGGGTCTTCCAACTCAGG - Intronic
1180948174 22:19708217-19708239 AAGACAGGGGCTGCTTTTGCAGG - Intergenic
1183026153 22:35067156-35067178 AGGACAGGCTCAGCTTCTTCGGG - Exonic
1183901418 22:41008970-41008992 AGGACAGGGCCTGGCATTTTGGG - Intergenic
1185023882 22:48396623-48396645 ATCACAGGGGCTGCATTTTCCGG - Intergenic
949289790 3:2450851-2450873 AGGACAGGGTCTGCCTTTTCAGG - Intronic
952860203 3:37806660-37806682 AGGGCAGAGTCTGCCTTCTCAGG - Intronic
952863415 3:37833753-37833775 ATGAAAGGGTGTGCCTCTTCTGG + Intergenic
954766465 3:52921980-52922002 AGGAAAATGTCTGCCTTTCCTGG + Intronic
955479712 3:59377201-59377223 AAGGCAGGGTCTGGCATTTCTGG - Intergenic
956677847 3:71752895-71752917 ATAACAGGGGCTGCCCTTTCAGG + Intronic
959475203 3:106802684-106802706 AGAACAGTCTCTGCCTATTCGGG + Intergenic
969474760 4:7415476-7415498 AGAAAAGGTTCTGCCTTTTAGGG + Intronic
970887739 4:21006179-21006201 AGGGCAGGTGCTGCCTTATCAGG - Intronic
971961300 4:33490572-33490594 ATGACAGGCTCTGCCTTTGTGGG - Intergenic
973833258 4:54783147-54783169 AGAAGAGGGTCTGCCTTGCCTGG - Intergenic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
981027928 4:140095194-140095216 AGGAGAGGTTCTTCCTATTCAGG - Intronic
981074627 4:140578806-140578828 AGGACAGGGCATGTCTGTTCTGG - Intergenic
982283079 4:153705935-153705957 AGGACAGAGAATGCCTTTTGTGG - Intergenic
982547439 4:156752131-156752153 AGGACTGAGTCTGCTTCTTCTGG - Intergenic
983176616 4:164596247-164596269 ATGACATGGTCAGTCTTTTCTGG + Intergenic
986299130 5:6464669-6464691 AGGGCCGTGTCTGCCTTCTCTGG + Intronic
987258078 5:16178612-16178634 AGGAAAGACTCTGCCCTTTCTGG + Intronic
988384170 5:30539727-30539749 AGGACTGGGTCCTTCTTTTCAGG - Intergenic
991106664 5:62851487-62851509 AGGCCAGGGGCTGCCTTTAATGG + Intergenic
992365676 5:76086619-76086641 ATGCCAGGGGCTGCCTTTCCTGG - Intronic
996234512 5:121108944-121108966 AGGGCAGGGGCCGCCTTCTCAGG + Intergenic
996582085 5:125042399-125042421 ATGTCAGGGTCTGGCTTTCCTGG - Intergenic
996791675 5:127299792-127299814 AGAACAGGGAAAGCCTTTTCTGG + Intronic
997517629 5:134502163-134502185 AGGGCAGGTCCTGCCTTCTCTGG - Intergenic
998036391 5:138920521-138920543 AGCACAGGATCTGGCTTTTGAGG + Intronic
998140058 5:139694679-139694701 AGGCCAGGGTCTGGCTTTCCAGG - Intergenic
999697072 5:154196639-154196661 AGGAGAGGGTCTGTCTCCTCTGG + Intronic
1000586308 5:163103245-163103267 AAGACAGTGTCTGCCTTTATGGG - Intergenic
1001533665 5:172482868-172482890 AGAACAGGGGCTGCCGGTTCCGG - Intergenic
1001740206 5:174046876-174046898 AGGACATGCTTTACCTTTTCTGG - Exonic
1002867065 6:1130913-1130935 AGGGCAGCGCCTGCCTTTCCGGG - Intergenic
1003969096 6:11281036-11281058 AGGACAAGGTTTTCCTTTTCAGG - Intronic
1005310029 6:24550255-24550277 AGCACAGAGCCTGCCTTTACAGG - Intronic
1005695229 6:28345608-28345630 AGGTGTGGGTTTGCCTTTTCTGG + Intronic
1006299251 6:33185147-33185169 AGGGCAGGGTCTGTCTGTGCTGG + Intronic
1006901117 6:37502309-37502331 AGCACAGAGTCTGGTTTTTCCGG - Intergenic
1007296047 6:40821368-40821390 AGGACAGGTTCTAACCTTTCTGG + Intergenic
1007307715 6:40919778-40919800 AGCACAGTGTCTGCTTTTGCAGG + Intergenic
1007470479 6:42086949-42086971 AGGACAGGGTCTACATCCTCTGG - Intronic
1010778995 6:79921610-79921632 AGGACAAGGTGAGCATTTTCAGG - Exonic
1011447016 6:87451900-87451922 AGGACCGGGCCTCCCCTTTCAGG - Intronic
1017331900 6:153208962-153208984 AGCACAGGGGCTGTCTTTCCTGG + Intergenic
1020894329 7:13920625-13920647 TGGACAGGGACTGCATTTTAAGG - Intronic
1021211868 7:17863590-17863612 GGGACTGGGTCTGTCTTATCAGG - Intronic
1021741566 7:23691124-23691146 AGGAGAGGGTCTGCATTACCTGG + Intronic
1023551516 7:41374724-41374746 AGGACAGGCCCTGCCTTAGCAGG - Intergenic
1024296217 7:47844365-47844387 AGGGCAGAGTCTGCATTTTCTGG - Intronic
1026953023 7:74360132-74360154 AGGACAGGGTCAGCATGCTCCGG - Intronic
1030771962 7:113486036-113486058 AGGCCAGTGTCTGTCTATTCTGG - Intergenic
1031919547 7:127590770-127590792 AGGAAAAGGTCTTTCTTTTCTGG + Intronic
1035666047 8:1380069-1380091 GGGGCAGGGGCTGCCTGTTCTGG + Intergenic
1037695800 8:21223000-21223022 AGGCCAAGGCCTTCCTTTTCTGG - Intergenic
1039894291 8:41705304-41705326 AGGACAGGGTCTCTCTGTGCAGG + Intronic
1040806438 8:51402007-51402029 AGGAAAGGGGCAACCTTTTCGGG + Intronic
1040951013 8:52939333-52939355 GGGAAGGGGTCTGCCTTTCCTGG - Exonic
1042545902 8:69951085-69951107 AGTACCGGGTCTGCATTTTTTGG - Intergenic
1045373349 8:101547472-101547494 AGGACAGGGACCACCATTTCTGG - Intronic
1046582426 8:116110148-116110170 AGGACTGGGTCTGCAGTTGCAGG - Intergenic
1048012035 8:130465629-130465651 AGGAAAGGCTCTGTCTCTTCTGG - Intergenic
1048828196 8:138450094-138450116 AGGAAAAGCTATGCCTTTTCAGG + Intronic
1049159357 8:141087447-141087469 AACACAGGGCCTGCCTTTTCTGG + Intergenic
1055550707 9:77429782-77429804 ACCACAGTCTCTGCCTTTTCAGG + Intronic
1056889593 9:90478411-90478433 ATGAAAGGGTCTGACTTTTAGGG + Intergenic
1057700054 9:97357373-97357395 AGGACAGGCTCTGCTTTAGCAGG - Intronic
1060702491 9:125769654-125769676 ACTACAGGGTCTGCCTTCTAAGG - Intronic
1062490693 9:136803549-136803571 AGGACAGGGTCTGCCTGTCCCGG - Intronic
1186746161 X:12571596-12571618 AGGCCATGTTCTGGCTTTTCTGG + Intronic
1187321851 X:18246239-18246261 AGGAGAGGGACTGTCTTTCCAGG + Intronic
1191870041 X:65738170-65738192 AGGAAAGGATCTGCCACTTCAGG + Intronic
1192208115 X:69109425-69109447 AGGACAGCGACTGCCTTGGCAGG + Intergenic
1195020228 X:100819686-100819708 CCGGCAGGGTCTGCCTTTCCGGG + Intergenic
1202038710 Y:20660943-20660965 TCAACAGGGTCTCCCTTTTCAGG + Intergenic