ID: 949290665

View in Genome Browser
Species Human (GRCh38)
Location 3:2461844-2461866
Sequence CTGTGTGACCCTAAGCAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949290665 Original CRISPR CTGTGTGACCCTAAGCAACT TGG (reversed) Intronic
901159455 1:7163751-7163773 CTGCGGGACCCAAAGCAACATGG + Intronic
902875780 1:19339943-19339965 CTATGTCACCCTAAGCCACAAGG + Intronic
904437319 1:30507228-30507250 CAGTGTGACCCTGTGCAAGTGGG - Intergenic
906019600 1:42615692-42615714 CTGTGTGACTTTTAGCAACAAGG + Intronic
910434416 1:87190730-87190752 TTGTGTGACCTTAAGCAACAGGG + Intergenic
910985694 1:93002690-93002712 CTCTGTGACCCAAAGCACCATGG + Intergenic
913122478 1:115754584-115754606 CTGTGTGTCCCCAGGCAAGTTGG - Intronic
913201945 1:116502057-116502079 TTGTGTGACTCTGGGCAACTCGG - Intergenic
915366367 1:155319029-155319051 CTGTGTGACCTTGAGCAAGTCGG + Intronic
918685388 1:187408552-187408574 CTGTCTCACCCTAACCATCTTGG + Intergenic
918768153 1:188515757-188515779 CTGTGTAATCCTAATCAAATTGG + Intergenic
922570659 1:226633024-226633046 GTGTGTGACCTTTAGCAAGTCGG + Exonic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1069685457 10:70315436-70315458 CTGTGTGACTTTCAGCAACAAGG - Intronic
1069905032 10:71727209-71727231 CTGTGTGACCCTGAACAAGTCGG - Intronic
1072531600 10:96324548-96324570 CTGTGTGATCTTGAGCAAGTTGG + Intronic
1072627852 10:97125332-97125354 CTGTGTGAGCCTGGGCAACATGG + Intronic
1073490744 10:103851585-103851607 CTGCGAGACCCTAAGCAAGTTGG + Intronic
1079029991 11:16979455-16979477 CTGTGTGACCTTGAGCAAGGTGG - Intronic
1080925182 11:36748811-36748833 CTGTGTGGCCTTAAGCAAGTTGG - Intergenic
1082019954 11:47524068-47524090 CTGTGGGGCCCAAAGCAACAGGG + Intronic
1085799149 11:79571992-79572014 CTGTGTGATCTCAAGCAAGTTGG - Intergenic
1089002324 11:115062090-115062112 TTGAGTGACCCTAAGCTCCTTGG - Intergenic
1092578860 12:9818380-9818402 GTGTGAGATCCTGAGCAACTGGG + Intergenic
1093867977 12:24251453-24251475 CTGTCTGACCCTAAGAAATAAGG - Intergenic
1099954131 12:89336362-89336384 CTGTCTGACGCTAAGCAAGTTGG - Intergenic
1100648167 12:96553039-96553061 CTCTGTGAACCTAAGAATCTAGG - Intronic
1101737285 12:107472493-107472515 CTGTGTGACCTTAGGCAATTTGG + Intronic
1102640130 12:114360176-114360198 CTGAGTGACCTTCAGCAAGTTGG + Intronic
1102814928 12:115858096-115858118 CTGTGTGTCCCCAGGCAGCTAGG - Intergenic
1104391181 12:128391716-128391738 CTGTGTGACCTAAAGCAAGGAGG - Intronic
1104887970 12:132122615-132122637 CTGTGTGGCCCTAAGGATTTTGG + Intronic
1107986320 13:45779589-45779611 CTGGGTGATCTTAAGCAAGTTGG + Exonic
1109401683 13:61839142-61839164 CTCTGTGACCCTAACCACATTGG + Intergenic
1110745885 13:79053101-79053123 CTGTGGCATCCTAAGCAAATTGG - Intergenic
1112109273 13:96276461-96276483 CTGTGTGATGCTCAGCAAGTTGG + Intronic
1115020872 14:28680180-28680202 TTGTCTGCCCCTAAGAAACTAGG - Intergenic
1116421378 14:44736715-44736737 CTGGGTGACACAAAGCCACTAGG - Intergenic
1120451742 14:84677242-84677264 CTTTGTCACCCTAAGCATATTGG + Intergenic
1120895988 14:89533126-89533148 TTATGTGGCCCCAAGCAACTTGG - Intronic
1124476980 15:30044126-30044148 CTGTGTAAACCTAAGAATCTAGG + Intergenic
1129952352 15:79603001-79603023 CTATGTGACCTTCAGCAAGTTGG - Intergenic
1130614789 15:85394722-85394744 CTGTGTGACCTTGAGCAGGTAGG + Intronic
1133228308 16:4353896-4353918 CTGTGGGACAGGAAGCAACTGGG - Intronic
1135245045 16:20848459-20848481 CTATGTGACCCTAGGAAAATTGG - Intronic
1135323043 16:21509567-21509589 CTGTGTGACTTTCAGCAAGTGGG - Intergenic
1136041108 16:27579623-27579645 CTGTGTGTCCCCAGGCACCTGGG + Intronic
1136334526 16:29602753-29602775 CTGTGTGACTTTCAGCAAGTGGG - Intergenic
1138655344 16:58488123-58488145 CTGTGTGACCTTGGCCAACTGGG - Intronic
1139745182 16:69068419-69068441 CTGTGTGAACCTGGGCAAATTGG + Intronic
1141383162 16:83594352-83594374 CAGTGAGAACATAAGCAACTTGG + Intronic
1141668652 16:85479979-85480001 CTGTGTGGCCTCAAGCACCTTGG - Intergenic
1141974202 16:87503909-87503931 CTGTGTGATCCTAATCACGTTGG + Intergenic
1143042995 17:4053228-4053250 CTGTGGGACCCCAAGATACTAGG - Intronic
1143263066 17:5614604-5614626 CTGTGAGCCCCTGAGCAACTGGG + Intronic
1143275085 17:5704331-5704353 CTGTGTGACCCTGGACAACATGG - Intergenic
1148742003 17:49898292-49898314 CTGTGTGACCCTCAGCACCCAGG + Intergenic
1149013144 17:51878366-51878388 AAGTATGACCCTAAGAAACTTGG + Intronic
1150970117 17:70018305-70018327 CAGTGTTCCTCTAAGCAACTGGG + Intergenic
1153782484 18:8506569-8506591 TTGTGGGACCCTGGGCAACTTGG - Intergenic
1154304830 18:13223088-13223110 CTGTGTGTCCGCAAACAACTAGG - Intronic
1155307958 18:24497799-24497821 CTGCGTGACCCCAAGAAACTAGG - Intergenic
1157133763 18:45034127-45034149 CTCTGTGACCTTGAGCAACCTGG + Intronic
1159465621 18:68779346-68779368 CTATGTGGCCTTAAGCAACATGG - Intronic
1159497524 18:69225110-69225132 CTGTGTCTCCCTAAGACACTGGG + Intergenic
1160325994 18:77948664-77948686 TTGGGTGACCCTGAGCAAGTAGG - Intergenic
1162153268 19:8660178-8660200 CTGTGTGACCCTAGGCAAGTCGG + Intergenic
1163144433 19:15371140-15371162 CTGTGTGACTCTAAGGACTTGGG + Intronic
1163317330 19:16550001-16550023 CTGTGAGACCCTAAGGTATTGGG + Exonic
1165891111 19:39112730-39112752 CTGTGTGACCATGGGCAAGTCGG + Intergenic
928200138 2:29242649-29242671 CTGTGTGACCTGAGGCAACATGG + Intronic
928697783 2:33867486-33867508 CTGTTTGACCTTCAGCAAATTGG - Intergenic
936506412 2:113111371-113111393 CTGTGTGACTCTGAGCCACTTGG - Intronic
936861908 2:117029339-117029361 ATGTGCGACCCTAAGAAACCAGG + Intergenic
938924507 2:136026376-136026398 CTGTGTGCCACTACTCAACTCGG + Intergenic
942130273 2:172871913-172871935 CTGTGTGACTCCAAGCAAGTTGG - Intronic
942214815 2:173708441-173708463 CTGTGTGACCTTAGACAATTTGG - Intergenic
942498944 2:176568029-176568051 CTGTGTGAATATAAGCAAATTGG + Intergenic
943472690 2:188314476-188314498 CTGTGTGACCTTGGGCAAGTGGG - Intronic
945757123 2:213860594-213860616 CTGTGACACCTTAAACAACTTGG - Intronic
948387939 2:237593252-237593274 CTGTGGGACCCTGAGCAGCGAGG - Intronic
1170493230 20:16899529-16899551 CTGAGTGACTCTATGCAACAGGG - Intergenic
1172773040 20:37392643-37392665 CTGTGTGACCTTGAGCAAAGAGG + Intronic
1174385865 20:50188465-50188487 CTGTGTGACCTTAGGCAAAATGG - Intergenic
1176268694 20:64224120-64224142 CTGTGTGACCCTGAGCCATGGGG + Intronic
1178307924 21:31506057-31506079 CTGTGGGACCTTGAGCAAGTTGG - Intronic
1181271060 22:21658624-21658646 CTGTGTGATCCTGAGCAAGTTGG + Intronic
1183265655 22:36823652-36823674 CTGTGTGATCCTGAGCCAGTTGG + Intergenic
1183505773 22:38208083-38208105 CTGTGTGACCCCAGCCAGCTGGG + Intronic
949168476 3:969470-969492 CTGTGTGACCCAGGGCAAGTCGG - Intergenic
949290665 3:2461844-2461866 CTGTGTGACCCTAAGCAACTTGG - Intronic
949763692 3:7501558-7501580 CTGTGTGACCTTAAACACATAGG - Intronic
954514505 3:51160619-51160641 CTGTGCGGTCCTAAGCATCTTGG + Exonic
954533786 3:51342966-51342988 CTGTGTGAGCCTAAGACAGTGGG - Intronic
955391091 3:58522817-58522839 CTGTGTGACCCTGGACAAATTGG - Intronic
957913422 3:86653686-86653708 CTGTGAAACCCTCAGCACCTGGG + Intergenic
957967299 3:87338895-87338917 CTGTGTGACCCAAGGCAAATTGG - Intergenic
959568130 3:107853445-107853467 CTGTGGGATCCTAATCCACTAGG + Intergenic
959922365 3:111882764-111882786 GTGTGTGAAGCTAAGCAACAGGG + Intronic
962013871 3:131420992-131421014 GTTTTGGACCCTAAGCAACTGGG - Intergenic
962620291 3:137171434-137171456 CTGTGTGACCCTGAGCTTCGAGG - Intergenic
964866407 3:161266823-161266845 CCATGTGACCCTAATCATCTCGG + Intergenic
965059623 3:163768528-163768550 CTGATTGACCCTAAGTAATTTGG + Intergenic
975657953 4:76660317-76660339 ATATGGGACCCTAAGCAGCTGGG - Intronic
981364792 4:143889876-143889898 CTGTGTGAACTTAAGCAAGTCGG - Intronic
989135381 5:38149305-38149327 CTGTGTGATCTTAGGCAACAAGG - Intergenic
990656196 5:57958804-57958826 CTGTGTGAGACTAAGGAAATTGG + Intergenic
996879884 5:128284298-128284320 CTCTGTGACCCTGGGCAAGTTGG - Intronic
997432657 5:133851464-133851486 CTGTCTGACTCTAGGAAACTTGG - Intergenic
998167137 5:139850647-139850669 CTGAGTGGCCCTCAGCAAGTGGG - Intronic
1002528214 5:179827191-179827213 CAGTGTGACCCCAAGCACCTGGG - Intronic
1006929701 6:37680342-37680364 CCCTGTGACCCTCAGCCACTAGG + Intronic
1008156838 6:48026054-48026076 CTGTATCACCCTAAGGAATTTGG + Intronic
1009584360 6:65578911-65578933 CTGTGTGACCATAAGAGAATGGG - Intronic
1009768698 6:68117360-68117382 CTATATGAACCTAAGAAACTAGG + Intergenic
1013462268 6:110386573-110386595 CTGTGTAAACCTAAACAACCTGG + Intergenic
1014383854 6:120777944-120777966 GTGTGAGACAGTAAGCAACTTGG - Intergenic
1014502334 6:122206550-122206572 CTTTGTGAACCTGAGCTACTTGG - Intergenic
1014663612 6:124206366-124206388 CTGTGTTCCCTTAAGCAAGTAGG - Intronic
1016139575 6:140592680-140592702 ATGTGTGACCCTAATAAAATGGG - Intergenic
1016736735 6:147487776-147487798 CTATGTGAACCTGGGCAACTGGG - Intergenic
1018515569 6:164576353-164576375 CTGTGTGGCCCTGAGCAATCAGG + Intergenic
1020884035 7:13800511-13800533 CTGTGTGACCCTAATGAGGTGGG + Intergenic
1021670790 7:23033002-23033024 CTGTGTGACCTTGATCAAGTTGG - Intergenic
1022055629 7:26731019-26731041 TTGTGTGACCGTGAGCAAATTGG - Intronic
1023872689 7:44271386-44271408 CTGTGTGGCACTGAGCAGCTCGG + Intronic
1024841870 7:53596096-53596118 CTGTGTGACCCTGTGAAACATGG + Intergenic
1032981373 7:137287401-137287423 CTGGGTGACCCTAAGCAGAAAGG - Intronic
1034896889 7:154881908-154881930 CTGTGAGGCCCGAAGCCACTGGG + Intronic
1035305016 7:157926586-157926608 CTGTGTGTTCCTGAGTAACTGGG + Intronic
1039105794 8:33988157-33988179 CTGTGTGACCCAAGACACCTCGG - Intergenic
1039225061 8:35379205-35379227 CTGTGTGACTATAAGTTACTAGG - Intronic
1040578800 8:48677931-48677953 GTGTGTGACCCAAATCAACACGG - Intergenic
1040586204 8:48744634-48744656 ATGTGTGCCTCTAAGCTACTCGG - Intergenic
1044237908 8:89853353-89853375 CTGTGTGACACTCTGCAAGTTGG - Intergenic
1044365581 8:91341678-91341700 GAGTGTGACCAGAAGCAACTGGG - Intronic
1044390612 8:91646094-91646116 CTGTGTGTGCCTGAGCAAGTAGG - Intergenic
1045835182 8:106512184-106512206 CTGTGTGACCTTGGGCAATTGGG - Intronic
1046192103 8:110809706-110809728 CTCTGTCACCCTCAGCAGCTGGG + Intergenic
1049422704 8:142523977-142523999 CTGTGTGGCTCTAAGCAGGTGGG + Intronic
1051522723 9:18008180-18008202 CTGTGTGACCCTCAGAAAATAGG + Intergenic
1052019336 9:23508105-23508127 CTGTGTGCAGCTTAGCAACTTGG + Intergenic
1054810324 9:69429120-69429142 CTGTCTGTCCCTAGGCACCTGGG - Exonic
1057205063 9:93166851-93166873 CTTTGTTACCCTAAGCGCCTGGG - Intergenic
1057217257 9:93235974-93235996 CTGTGTGCCCCTGAGGAAGTGGG + Intronic
1057402960 9:94740786-94740808 CTGTGTAACCTTAAGCAAGCTGG + Intronic
1057820525 9:98326917-98326939 CTCTATGACCCTGAGCAAGTAGG - Intronic
1060903526 9:127283156-127283178 CTGGGTGACCCAAATCAAATTGG - Intronic
1061858586 9:133456411-133456433 CTATGTGACTCTAAGTAACTGGG - Intronic
1186446385 X:9633529-9633551 CTGTGTGAGCCTCATCCACTGGG - Intronic
1188532584 X:31158914-31158936 CTGGGTTAGCCTAAACAACTTGG + Intronic
1189488091 X:41447864-41447886 CTGGGTGGTCCTAAGCCACTGGG + Exonic
1192100315 X:68257445-68257467 CTGTGTGACCTTGAACAAGTAGG + Intronic
1192562931 X:72139390-72139412 CTGGGTGACCCTGAGCATCTGGG - Exonic
1193770511 X:85582100-85582122 CTGTGTGATCCTGGGCAAGTTGG - Intergenic
1196055371 X:111349584-111349606 CTGTATGTCCCTTACCAACTGGG - Intronic
1197521915 X:127509323-127509345 ATGTGTGACCTTATGGAACTTGG - Intergenic
1198194089 X:134342606-134342628 CTGTGTGACCTTGAGCAAGTTGG + Intergenic
1198919618 X:141710850-141710872 CTGTGTGACCCTAACCCCCTTGG + Intergenic
1199860583 X:151797418-151797440 CTTTGTGCTCCTCAGCAACTAGG + Intergenic
1200945115 Y:8827531-8827553 TTTTGTGACCCTAATCACCTTGG + Intergenic