ID: 949293339

View in Genome Browser
Species Human (GRCh38)
Location 3:2491347-2491369
Sequence CCATTAGAGCGTAAGGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 26}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949293339 Original CRISPR CCATTAGAGCGTAAGGCATC TGG (reversed) Intronic
906572889 1:46859753-46859775 ACATTGTGGCGTAAGGCATCTGG + Intergenic
911051798 1:93677629-93677651 ACATCAGAGCTTGAGGCATCTGG + Intronic
920972912 1:210757881-210757903 CCATTAGAGCAGCAGGCCTCTGG - Intronic
1065172346 10:23044031-23044053 CCAGTAGAGCATAAGGCATCAGG - Intergenic
1071353633 10:84771182-84771204 CAATTAGATTGTAAGCCATCAGG + Intergenic
1108424408 13:50284381-50284403 CCACTAGAGTATAATGCATCAGG - Intronic
1123200267 14:106656870-106656892 ACCTTAGAGCGTTAGGCATAGGG + Intergenic
1123970731 15:25505670-25505692 ACATTAGAGCATAAGGCACCGGG + Intergenic
1129741859 15:77993137-77993159 CCATTAGGGCGTAGGGCGTAGGG - Intronic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1153025702 18:670432-670454 CCATCAGAGCTGAAGGGATCTGG - Intronic
1167691767 19:50989325-50989347 ACATGAGAACGTAAGGCATTTGG + Intergenic
928572334 2:32622180-32622202 CCTTTAGAGCTTGAAGCATCAGG - Intergenic
946825003 2:223668726-223668748 CCTTTAGTGTTTAAGGCATCTGG + Intergenic
949293339 3:2491347-2491369 CCATTAGAGCGTAAGGCATCTGG - Intronic
985270893 4:188193917-188193939 TTATTAGAGAGAAAGGCATCTGG + Intergenic
988369020 5:30343123-30343145 CAATTAGAGAGTATGGCATATGG - Intergenic
1009909623 6:69909780-69909802 TCATTAGAACTTAAGCCATCTGG - Intronic
1013741560 6:113292924-113292946 CCATTTGAGTGTCAGTCATCTGG + Intergenic
1016760139 6:147727642-147727664 CCACTAGAGACTTAGGCATCTGG + Intronic
1020467899 7:8501869-8501891 CAATTAGAGGGTAAGGCCTAGGG + Intronic
1021367860 7:19803613-19803635 CCATTAGAGAGTAATCCTTCAGG - Intergenic
1023222581 7:37934536-37934558 CCCTTAGAGCTAAAGGTATCTGG - Intronic
1031322964 7:120356183-120356205 CCATTAGAGCATTAGTCATATGG - Intronic
1031620176 7:123925963-123925985 CAATTAGACCCTATGGCATCAGG - Intronic
1036144983 8:6246479-6246501 CCATGAGCACGTCAGGCATCAGG - Intergenic
1039476259 8:37840892-37840914 CCAGTGGAGTGGAAGGCATCTGG - Intronic
1189007080 X:37008346-37008368 CGACTAGAGCGTCAGGGATCAGG + Intergenic
1201923688 Y:19261802-19261824 CCATTAGTGCCTTAGGCATAAGG - Intergenic