ID: 949295624

View in Genome Browser
Species Human (GRCh38)
Location 3:2519171-2519193
Sequence CTTGAAACACAGTTGGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949295624_949295630 29 Left 949295624 3:2519171-2519193 CCTTGTACCAACTGTGTTTCAAG 0: 1
1: 0
2: 0
3: 11
4: 177
Right 949295630 3:2519223-2519245 AAAGTGGCATATTCTGATAAGGG 0: 1
1: 0
2: 1
3: 30
4: 339
949295624_949295629 28 Left 949295624 3:2519171-2519193 CCTTGTACCAACTGTGTTTCAAG 0: 1
1: 0
2: 0
3: 11
4: 177
Right 949295629 3:2519222-2519244 CAAAGTGGCATATTCTGATAAGG 0: 1
1: 0
2: 1
3: 30
4: 271
949295624_949295626 13 Left 949295624 3:2519171-2519193 CCTTGTACCAACTGTGTTTCAAG 0: 1
1: 0
2: 0
3: 11
4: 177
Right 949295626 3:2519207-2519229 AAATAATCCTTTTGCCAAAGTGG 0: 5
1: 64
2: 144
3: 260
4: 554

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949295624 Original CRISPR CTTGAAACACAGTTGGTACA AGG (reversed) Intronic
901295427 1:8157402-8157424 TTGGAGACGCAGTTGGTACATGG + Intergenic
901957159 1:12794782-12794804 CTTGAAACACACTTTGTAACAGG - Intronic
901965174 1:12860560-12860582 CTTGAAACACACTTTGTAACAGG - Intronic
901980567 1:13030914-13030936 CTTGAAACACACTTTGTAACAGG - Exonic
902001521 1:13198017-13198039 CTTGAAACACACTTTGTAACAGG + Exonic
902020756 1:13343727-13343749 CTTGAAACACACTTTGTAACAGG + Intronic
902912876 1:19613658-19613680 CCTGGCACACAGTGGGTACACGG + Intronic
905636017 1:39553027-39553049 TTGGAAACACAATAGGTACATGG + Intergenic
906645222 1:47469969-47469991 CTTGAAAGGCAGTTGGGGCAAGG + Intergenic
908590508 1:65627137-65627159 TTTGAACCACAGATGTTACATGG - Intronic
908597505 1:65704154-65704176 CTTGAAACACAGCTGGTATTAGG - Intergenic
909744935 1:79083015-79083037 CATGAAACACAGTTTATGCAGGG - Intergenic
909873631 1:80777489-80777511 CCTAAAACAAAGTTGGTCCATGG + Intergenic
910518650 1:88092050-88092072 TTTGAAAAACACTTGTTACACGG + Intergenic
911268568 1:95773463-95773485 CTTAAAACACAATTGGAATAAGG + Intergenic
913718947 1:121571470-121571492 CTTGAACTAGACTTGGTACATGG + Intergenic
919638743 1:200029429-200029451 CTGGAAACACAGTTCTTCCAGGG - Intronic
919912813 1:202122423-202122445 CTTGCCACATAGTTGATACAAGG - Intergenic
920841891 1:209562144-209562166 CTGGAAACACAGGGGGTGCAGGG + Intergenic
921500378 1:215895152-215895174 CCTGGTACACAGTAGGTACACGG + Intronic
922473682 1:225891391-225891413 CTTGGAACACAGGCTGTACAAGG + Intronic
1064422805 10:15204921-15204943 CATGGAACACAGGTCGTACAGGG + Intergenic
1065459091 10:25936853-25936875 CTTTAAGCACAGTAGGTACCTGG + Intronic
1066213007 10:33258137-33258159 CTAGGAACACAGCTGGTACTTGG - Intronic
1066449534 10:35516080-35516102 CTTGAAATACAGTTGATTTAGGG - Intronic
1067061124 10:43078393-43078415 CTGGAAACTCAGTTTGTGCAGGG - Intronic
1068818816 10:61349358-61349380 CTTGGAACACATTTGGAAGATGG + Intergenic
1070989442 10:80718622-80718644 TTTAAAACACAGTTGGTACCTGG + Intergenic
1075247751 10:120838991-120839013 CTTCTAACACCCTTGGTACAAGG - Intergenic
1075290207 10:121222891-121222913 CATAAAACACAGTTGTTAAATGG + Intergenic
1076430330 10:130397564-130397586 CTTGAAACACATTTCTTACGTGG - Intergenic
1077209828 11:1364783-1364805 CTGGAAACACTGCTGGTACCAGG + Intergenic
1077238887 11:1500370-1500392 CTTTAAACACAGGCGGTTCACGG + Intronic
1078977555 11:16495560-16495582 CTTGAACCACAGGTGGCACATGG - Intronic
1079579691 11:22048232-22048254 CTAGTGACACAGTTAGTACATGG + Intergenic
1079710168 11:23672927-23672949 CATAAAACAAAGTTGGTACTAGG - Intergenic
1079995663 11:27292783-27292805 CTTGAAATACAGTTGGTGATGGG - Intergenic
1080848385 11:36046237-36046259 CATGCAACAGAGCTGGTACAGGG - Intronic
1080894820 11:36440342-36440364 CTTTAAACACAGGAGGTACTAGG + Intronic
1083076006 11:60039031-60039053 CTTGAAGCACAGTTAGTAACAGG - Intergenic
1086614268 11:88796159-88796181 CTTGAAACACATTGTGTCCATGG - Intronic
1087458574 11:98419013-98419035 CTGGAAACTCTGTTGATACAAGG + Intergenic
1088416109 11:109590718-109590740 CTTGAAATACAGTGGATTCAGGG + Intergenic
1089783181 11:120888898-120888920 CCTGCAACTCAGTTGGTCCAAGG - Intronic
1090628776 11:128628078-128628100 CTTGACGCACAGATGGGACATGG - Intergenic
1090825056 11:130379329-130379351 CTTGGAACACAGGTAATACAGGG - Intergenic
1091194889 11:133722086-133722108 CTTCAAACACAGCTGGTTCTAGG - Intergenic
1093399213 12:18723733-18723755 CTTGAAACCCAGTGGTTATAGGG + Intronic
1094397268 12:30021416-30021438 CTTGTAACATATTTGTTACAGGG + Intergenic
1097771856 12:63595740-63595762 CTTGATACACAGTTGGTGACTGG + Intronic
1099143245 12:79006846-79006868 TTTGAAACACAGTTTGTTAATGG + Intronic
1100040632 12:90313137-90313159 CTTGAAAGACAGTTGGTGGTTGG + Intergenic
1102819265 12:115894201-115894223 GTTGAACCAGAGTTGGTCCAAGG + Intergenic
1102887403 12:116532576-116532598 CTAGAGAGACAGTTGATACAGGG + Intergenic
1109558180 13:64009035-64009057 CTTCAAGCACAGTTGGTTCCAGG - Intergenic
1111249016 13:85579347-85579369 CTTAACACAAAGTTGGTTCAGGG - Intergenic
1111353240 13:87061559-87061581 ATAGAAGCTCAGTTGGTACACGG + Intergenic
1112087428 13:96046604-96046626 CTTGTCAGACAGTGGGTACAGGG + Intronic
1113084891 13:106558833-106558855 CTTGAAACACATTAGGAAAATGG + Intronic
1113793593 13:113043613-113043635 TGTGAGACACAGTGGGTACAGGG - Intronic
1115812603 14:37126533-37126555 ATTGAAAGACATTTGTTACAAGG + Intronic
1117903723 14:60562647-60562669 CTTGGCACAGAGTTGGCACATGG + Intergenic
1119234379 14:73007153-73007175 CTTGGAACAGAGCCGGTACATGG - Intronic
1119727775 14:76932570-76932592 CCTGGAACACAGTAGGTACAGGG + Intergenic
1125126583 15:36230452-36230474 CTTGGAACTCTGCTGGTACAAGG + Intergenic
1125876506 15:43151542-43151564 CTTGAACAACACCTGGTACACGG - Intronic
1127894189 15:63280299-63280321 TTTGAAACACAGCTGGAACTTGG + Intronic
1131101303 15:89691980-89692002 CTGGAAACACAGCTGGAATATGG + Intronic
1131228683 15:90645456-90645478 CCTGACCCACAGCTGGTACAGGG - Intergenic
1133052976 16:3128775-3128797 CTTGATACAAAATTAGTACAAGG - Intergenic
1134371106 16:13625734-13625756 CCTGATACACTGTTGGTATAAGG - Intergenic
1135038092 16:19095134-19095156 CTTGAAACAGAATAGGTTCAGGG + Intergenic
1143848120 17:9788523-9788545 CTGCAGACACAGTGGGTACAAGG + Intronic
1143941714 17:10549250-10549272 CCTGAAGCACAGTTGTTAAAGGG + Intronic
1144877509 17:18409125-18409147 CTGGAAACACAGTTGTGAAAAGG - Intergenic
1147398926 17:40167401-40167423 GTTGAAAAACACTTGGTACATGG - Intronic
1150883723 17:69060890-69060912 CTAGAAACACAGTTCATCCATGG + Exonic
1152037253 17:77881025-77881047 CTTGGCACACAGTAGGTGCACGG + Intergenic
1155506052 18:26533957-26533979 ATTGAAACACATTTGGAATATGG + Intronic
1156432507 18:37091581-37091603 CTTGAGTCTCAGTGGGTACATGG - Intronic
1156647745 18:39186922-39186944 CCTGAAACACAGTTGACACATGG - Intergenic
1157723109 18:49941073-49941095 CATGAAACACAGTTGTTTCATGG - Intronic
1162356099 19:10185926-10185948 CTTGGACCCCAGTTGCTACAAGG - Intronic
1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG + Intronic
1163137332 19:15321892-15321914 TCTAAAACACAGTGGGTACAGGG + Intronic
1164554352 19:29239543-29239565 CTTTAAACCCAGTGGGTGCAGGG - Intergenic
1165038657 19:33053342-33053364 CTGGAAATACAGTTGATTCATGG - Intronic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
926043984 2:9696145-9696167 CTTTGAACACAGGTTGTACAAGG - Intergenic
926093199 2:10063761-10063783 CGAGAAGCACAGTGGGTACAGGG + Intronic
926821578 2:16857185-16857207 ATTTAGACACAGTGGGTACATGG + Intergenic
929049670 2:37825408-37825430 GTTGAAAAACAGATGGTCCAGGG + Intergenic
929210999 2:39357033-39357055 ATTATAACACAGTTGGAACAAGG - Intronic
936574674 2:113642983-113643005 CCTGAAACAGAGTGGGTACACGG - Exonic
936959613 2:118059183-118059205 CATGAAGCACAGTTGGTCCATGG + Intergenic
938626643 2:133116897-133116919 GTAGAAACACAACTGGTACAAGG + Intronic
943218334 2:185069337-185069359 CTTTAAACACAGGTGGCCCAGGG - Intergenic
944418794 2:199506362-199506384 TTTTAAACACAGTTGTAACATGG - Intergenic
945154508 2:206824426-206824448 CATAAAACTCAGTTGGTACGAGG + Intergenic
945888081 2:215398273-215398295 TTTGCAATACAGTTGCTACAGGG - Intronic
947835978 2:233175997-233176019 CTTGAAAGAAAATTGGTAAAAGG + Intronic
948256474 2:236572378-236572400 CTTGAACCACTGTTGGCAAAGGG + Intronic
1169647666 20:7832063-7832085 ATTGAAATACAGTTTGTCCAGGG - Intergenic
1169923677 20:10760620-10760642 CTTCAAACACTGTTGGCACTGGG - Intergenic
1172707038 20:36889463-36889485 TTTGAAACACAGATGGTGAAGGG + Intronic
1172822305 20:37747895-37747917 CTTGATACATAGTAGGTACTTGG + Intronic
1173705954 20:45110473-45110495 CTTGTGACACAGGTGGTTCATGG + Exonic
1178277315 21:31250681-31250703 CTTGAAACAGGGTTAATACATGG - Intronic
1180013400 21:45066174-45066196 CTGGAAAGACTGCTGGTACAAGG + Intergenic
1183575120 22:38683093-38683115 CATGGAACACAGTTTTTACATGG + Intronic
949143736 3:669154-669176 CTGTAAACATAGTTTGTACAGGG - Intergenic
949180727 3:1127877-1127899 CATGAAACACAGATTGTTCAAGG + Intronic
949295624 3:2519171-2519193 CTTGAAACACAGTTGGTACAAGG - Intronic
952101486 3:30018040-30018062 CTTGGAACACAGGTGGTCCAAGG - Intergenic
955288579 3:57669338-57669360 CTTGAAGTATGGTTGGTACAAGG - Intronic
959585551 3:108022060-108022082 CTTGAGACAGAGTAGGAACAAGG + Intergenic
959926525 3:111927772-111927794 CTTGATAAACAGATGGTTCAAGG - Intronic
961966054 3:130903875-130903897 TTTGAAAGAAATTTGGTACAAGG - Intronic
962248819 3:133822210-133822232 CTTGAAACACCTTGGGAACATGG + Intronic
970249703 4:14101415-14101437 CTGGAAATACAATTGGTGCAGGG + Intergenic
971461165 4:26898627-26898649 CATGAAATACAGTTGATAAAAGG + Intronic
975588882 4:75980216-75980238 ATTGATACTCAGCTGGTACATGG - Intronic
975650901 4:76591845-76591867 CTAGAAACCCAGCTGATACATGG - Intronic
975996853 4:80325263-80325285 GTTGAAACACAGTAGGTAGCTGG + Intronic
978667725 4:111206002-111206024 CTTGAAACACAACTGATAAAAGG - Intergenic
979560621 4:122097510-122097532 ATTGAAACAGGGTTGGCACAAGG - Intergenic
981171924 4:141636057-141636079 TGTGCAAGACAGTTGGTACAGGG - Intergenic
982592408 4:157331316-157331338 CCTCAAACACATTTGGTAGACGG + Intronic
990146913 5:52771621-52771643 ATTGGAAAACAGTTGGTTCATGG + Intergenic
990433643 5:55764984-55765006 CTTAAAACACTTTTGGTATAAGG + Intronic
991420415 5:66435295-66435317 CTTGAAGAACAGTTGGCAAATGG - Intergenic
993153092 5:84185407-84185429 CTTGAAAAAAAGTCTGTACAAGG - Intronic
993673481 5:90790213-90790235 CTTAAAAAACAGTTGCTAAATGG - Intronic
999040364 5:148402976-148402998 TCTGAAACTCAGGTGGTACAGGG + Intronic
999102230 5:149036263-149036285 CTGGAAGCACAGTAGCTACATGG - Intronic
1000978840 5:167794726-167794748 CTTGAAAGATAATTGGTGCAGGG + Intronic
1001473300 5:172031336-172031358 ATGGAAAGAAAGTTGGTACAGGG + Intergenic
1003521847 6:6864952-6864974 CTTGCAACACAGTAGGTAATAGG + Intergenic
1003917811 6:10804005-10804027 CCTGACACACAGATGGAACAGGG - Intronic
1007249950 6:40488721-40488743 CCTAAAACACAGTGGGTATAGGG - Intronic
1007963045 6:45978537-45978559 GTTAAAACACAGTAGGTCCAGGG + Intronic
1008522535 6:52375830-52375852 CTTTAAACACTGATGGTTCATGG + Intronic
1008872549 6:56289747-56289769 CTTGGAACACAGGCTGTACAGGG + Intronic
1009773790 6:68178791-68178813 CATGTAAGATAGTTGGTACAAGG + Intergenic
1010648268 6:78420573-78420595 CTTTCAACATAGTTTGTACAAGG - Intergenic
1011005942 6:82645747-82645769 CTTGAGACACAATTGGACCAGGG - Intergenic
1011605947 6:89105438-89105460 ATTGAAATACAGTTTGCACAAGG - Exonic
1012192873 6:96301762-96301784 CATAAAACGCAGTTGATACATGG - Intergenic
1012415094 6:99004556-99004578 CCTTAAAAACAGTTGGTATATGG - Intergenic
1012626576 6:101411215-101411237 TTTGAAAGATAGTTGATACATGG - Intronic
1012827075 6:104160037-104160059 CTAGAAACACAGGTGGCAGAGGG + Intergenic
1014371225 6:120610160-120610182 CTTGAAAGAGAGTTGTTGCAAGG + Intergenic
1015291744 6:131545380-131545402 CTTTGAACACAGGTGGTACAAGG + Intergenic
1016619340 6:146090114-146090136 CTTCACACACAGAAGGTACATGG - Intronic
1017050379 6:150387245-150387267 CATTAAACACAGCTGCTACAAGG - Intronic
1017404461 6:154103448-154103470 TTAGAAACACAATTGGTATAGGG - Intronic
1020736001 7:11950118-11950140 CTGGCAACAATGTTGGTACAGGG + Intergenic
1022366322 7:29722596-29722618 CTTGATACACAGTTGGTGACTGG - Intergenic
1022776344 7:33531572-33531594 CTTGAAACTCAGTTTATATAAGG + Intronic
1022931421 7:35119423-35119445 CTTGATACACAGTTGGTGACTGG + Intergenic
1024430075 7:49278107-49278129 CCTTAAACAGTGTTGGTACATGG - Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1028774269 7:94659828-94659850 CTGGAAACACAATTCTTACATGG - Intronic
1029827311 7:103211935-103211957 CTTGATACACAGTTGGTGACTGG + Intergenic
1029952427 7:104601378-104601400 CCTAGAACACATTTGGTACATGG - Intronic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1032567882 7:132967130-132967152 CTTGCAAACCAGTTGGTTCAGGG - Intronic
1040775541 8:51038753-51038775 CTAGTAACAGAGTTGATACATGG - Intergenic
1042497235 8:69469116-69469138 CTTGAAACACAGTGTCCACAGGG + Intronic
1045657724 8:104404192-104404214 CCTAAGACACAGTTGGCACATGG + Intronic
1046228497 8:111319238-111319260 ATTGAAACACAGTTGGTGAGCGG + Intergenic
1048318716 8:133381850-133381872 CTTGATACACTGTTGCTCCAGGG + Intergenic
1049059247 8:140263361-140263383 CCTGAAGCACAGTGGGTACTGGG + Intronic
1050981428 9:12020671-12020693 CATGAGAAACAGTGGGTACATGG - Intergenic
1051557466 9:18401081-18401103 CTTAAACCACAGTTGGTTAATGG - Intergenic
1051749126 9:20323225-20323247 CTTGAAAAAGTGTTGGTACCTGG + Intergenic
1053120412 9:35542639-35542661 CTTGGAACACAGTAGGTGCCTGG - Intronic
1055835973 9:80442414-80442436 TGTGAAACAGAGTTGGAACAGGG + Intergenic
1058646704 9:107137691-107137713 CCTGGCACACAGTAGGTACACGG + Intergenic
1186071061 X:5821215-5821237 CTGGAAACACAAATGGCACACGG + Intergenic
1186592617 X:10947103-10947125 CTGGCACCACAGTTGGCACATGG + Intergenic
1187686597 X:21821729-21821751 TTTCTACCACAGTTGGTACATGG + Intergenic
1192112226 X:68376724-68376746 CACAAAGCACAGTTGGTACAAGG - Intronic
1193935411 X:87613059-87613081 CTTTTAAGACAGTTGGTCCAAGG - Intronic
1194288975 X:92045539-92045561 TATGAAACAGAGTTGTTACAAGG + Intronic
1195156990 X:102133451-102133473 CTTGAATTTCAGTTGGTACCAGG + Intergenic
1195251802 X:103055397-103055419 TTTGAAACAAAGTTGTTAAATGG - Intergenic
1197882236 X:131178885-131178907 TTTGACATACAGTAGGTACAGGG - Intergenic
1199651482 X:149949124-149949146 TTTTAACCACAGTTGGTTCAGGG + Intergenic