ID: 949298523

View in Genome Browser
Species Human (GRCh38)
Location 3:2555827-2555849
Sequence TATGGTAATATAGCTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949298523 Original CRISPR TATGGTAATATAGCTGTGGC TGG Intronic
902670214 1:17968019-17968041 TTTGGTAATAAGTCTGTGGCAGG + Intergenic
906271596 1:44483669-44483691 TATGAGAACATAGCGGTGGCAGG + Intronic
906785904 1:48615778-48615800 TATGATAAAATACCTGAGGCTGG + Intronic
916453880 1:164950270-164950292 TTTGGGAAGGTAGCTGTGGCTGG + Intergenic
918856393 1:189761162-189761184 TATCCTAATATATATGTGGCAGG - Intergenic
1065739374 10:28783434-28783456 TATGGTTCCATAGCTGTGGAGGG + Intergenic
1068813759 10:61286286-61286308 TCTTGTAATCTAGCTGAGGCAGG + Intergenic
1069138128 10:64790408-64790430 TATGCTAGTATAGCAGTAGCAGG + Intergenic
1075200925 10:120403316-120403338 TATGGTAATGTAGCTATTTCAGG + Intergenic
1078913350 11:15754645-15754667 TATGTTAATATTTCTGTAGCTGG + Intergenic
1081067038 11:38556020-38556042 TATGGTTATATAGTTGATGCAGG - Intergenic
1081092619 11:38891585-38891607 AATGGTAATATTGCTGGGACTGG - Intergenic
1082259441 11:50066728-50066750 TATTGTCATCTAGCTCTGGCTGG - Intergenic
1086183996 11:83991642-83991664 TATGGTAAGGAGGCTGTGGCAGG - Intronic
1086408607 11:86521091-86521113 TATTAAAATGTAGCTGTGGCCGG + Intronic
1086772155 11:90779946-90779968 GATGGGTATAGAGCTGTGGCTGG + Intergenic
1092675701 12:10916510-10916532 TATGGTTCTCTATCTGTGGCAGG - Intronic
1093483877 12:19632666-19632688 AATAATAATATAGCTGTTGCTGG + Intronic
1093862582 12:24185153-24185175 GATGGTAATATATCTGTGTAAGG - Intergenic
1096428548 12:51524338-51524360 TATGATAAAATAATTGTGGCCGG - Intergenic
1097258296 12:57697075-57697097 TATGGAAAGATAACTCTGGCAGG - Intronic
1097655638 12:62359104-62359126 TATGGTAAAATTGCTTTGGTTGG + Intronic
1099566125 12:84248732-84248754 TATGGTAATAAAGCTGTTGTTGG - Intergenic
1099636619 12:85221887-85221909 TATGGAGATATATCTGTGGGAGG + Intronic
1100456904 12:94760478-94760500 TGTGTTAATATTACTGTGGCAGG + Intergenic
1104475882 12:129069936-129069958 TATGGTAAAGTACCTGTAGCCGG + Intergenic
1118717208 14:68568963-68568985 TATTGGAATTTAGATGTGGCTGG + Intronic
1121812848 14:96906826-96906848 TATGGTTATCTGGCTGTAGCTGG - Intronic
1125159811 15:36630004-36630026 TATGGTAATTTAGGAGAGGCTGG + Intronic
1135046145 16:19157557-19157579 TATGGAAATAGAGTTATGGCTGG - Intronic
1135386189 16:22042666-22042688 TATGGTAATAGAGCACTGGGTGG - Intronic
1138092145 16:54183654-54183676 TATTGTGAAATAGCTGTGGCGGG + Intergenic
1138770336 16:59655207-59655229 TATGATAATTTTGCTGTTGCAGG - Intergenic
1139101091 16:63767816-63767838 TCTGGAAACACAGCTGTGGCAGG + Intergenic
1139905419 16:70362232-70362254 TGTGGTCATGTAGCTGAGGCAGG + Intronic
1149567537 17:57650640-57650662 TATGGTAATAGGGCTGTTGAAGG - Intronic
1156706090 18:39884162-39884184 TATGGTAAATTAGCTTTGTCTGG - Intergenic
1164925068 19:32124139-32124161 TCTGGAAATATCACTGTGGCAGG + Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
934607037 2:95703683-95703705 TATGGTTAAATAGTTGTTGCAGG + Intergenic
935251446 2:101265536-101265558 TTTGGTAATTTTGCTGTGGTGGG + Intronic
937651084 2:124319883-124319905 TATAGTTATAAAGCTGTGGAAGG - Intronic
938309713 2:130281026-130281048 TCTAGTAATATAGCTGTGGCAGG + Intergenic
942271433 2:174279750-174279772 TATAAGAATATGGCTGTGGCCGG + Intergenic
944881389 2:204016619-204016641 CATGGAAATACAGCTGTGGTTGG + Intergenic
944908908 2:204290173-204290195 GATGGTATGATAGCTGTGTCTGG + Intergenic
948588105 2:239033953-239033975 AATGGAAATATGGCTGGGGCTGG + Intergenic
1169703301 20:8473615-8473637 TATTGCACTAGAGCTGTGGCAGG - Intronic
1173181739 20:40811448-40811470 GGGGGTCATATAGCTGTGGCTGG + Intergenic
1177685367 21:24429587-24429609 TATGGTAAGATAGCAGTGCTAGG - Intergenic
1178816600 21:35935827-35935849 TCTGTTAATTTAGCTCTGGCTGG + Intronic
1178954694 21:37011668-37011690 TATGAAAATATGGCTGGGGCCGG + Intronic
1180621208 22:17163565-17163587 TGTGGTCATATAGGTGTGGCTGG - Intronic
949298523 3:2555827-2555849 TATGGTAATATAGCTGTGGCTGG + Intronic
952374113 3:32750838-32750860 TATTGTTATATAGCTGGGCCCGG - Intronic
960887818 3:122414800-122414822 TATGGGATTATAGCAGAGGCAGG - Exonic
963621482 3:147612847-147612869 TATGGCGATATAGCCGTGGTGGG + Intergenic
970506152 4:16732609-16732631 TATAGAACTATAGCTGTGGATGG - Intronic
974684639 4:65211287-65211309 TGTGGTAATATGGCTGCAGCTGG + Intergenic
976455886 4:85246498-85246520 CAAGGTAATATAGCTGCTGCTGG + Intergenic
983177137 4:164603185-164603207 TATGGTAACATGGATGTAGCTGG + Intergenic
983730590 4:170988747-170988769 TTTGTTAATCTAGCTGTGGGGGG + Intergenic
984969961 4:185179257-185179279 AATGTTAATAAATCTGTGGCCGG + Intronic
987161695 5:15151443-15151465 TTTTGTAATATAGGAGTGGCAGG + Intergenic
994215820 5:97136022-97136044 CCTGGTTAGATAGCTGTGGCAGG - Intronic
1000509368 5:162163456-162163478 TATGCTAAGAAAGATGTGGCGGG + Intergenic
1000812187 5:165876971-165876993 TATGGTCATTTAGCTGTGGTAGG + Intergenic
1007603572 6:43099732-43099754 TATGCTAATAAATCTGTGCCAGG + Intronic
1010059345 6:71605054-71605076 TGTGGGAATATATCTGTGTCTGG - Intergenic
1011824288 6:91288095-91288117 TATGGTAATTTAGCTGGGTGGGG + Intergenic
1021272288 7:18605035-18605057 TATGTTAATCTGGCTGGGGCTGG + Intronic
1029870639 7:103688467-103688489 TATGATAGTATTGCTGTGTCAGG + Intronic
1029913986 7:104187523-104187545 AATAGTAATATATCTGAGGCTGG - Intronic
1030864913 7:114689124-114689146 TATAATTATATTGCTGTGGCTGG + Intronic
1032184739 7:129714793-129714815 TATGGTAATATAACTAAAGCAGG + Intronic
1033742221 7:144284247-144284269 TCTGTTGATCTAGCTGTGGCCGG + Intergenic
1033751681 7:144365367-144365389 TCTGTTGATCTAGCTGTGGCCGG - Exonic
1037427034 8:18767449-18767471 CATCGTAATATACCTGTGACCGG + Intronic
1043782492 8:84353405-84353427 ACTGGGAATATTGCTGTGGCAGG - Intronic
1046290337 8:112150975-112150997 TCTGATCATATAGCTGTGGGGGG + Intergenic
1047072405 8:121360354-121360376 TTTGGTAATCTAGATTTGGCTGG - Intergenic
1050932562 9:11348979-11349001 TATGGTAATATAAATGATGCAGG + Intergenic
1057511309 9:95681521-95681543 GCTGGTCATATAGCTGTGTCCGG - Intergenic
1187213463 X:17252528-17252550 TATGCGTATATAGGTGTGGCTGG - Intergenic
1189165422 X:38856352-38856374 TTTAATAATATAGCTATGGCTGG + Intergenic
1193514601 X:82447623-82447645 TATGGTATTCTTGCAGTGGCTGG - Intergenic
1196034956 X:111134186-111134208 TATGGTAACATAGCTGGGCATGG - Intronic
1196729867 X:118929850-118929872 TATAATAACATAGGTGTGGCCGG - Intergenic