ID: 949300485

View in Genome Browser
Species Human (GRCh38)
Location 3:2577880-2577902
Sequence GGTAAACTGCACCACAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949300485 Original CRISPR GGTAAACTGCACCACAGAGA TGG (reversed) Intronic
900574405 1:3375930-3375952 GGGAAACTCCACAGCAGAGATGG + Intronic
900975638 1:6014597-6014619 GGCAAGCAGCACCACAGAGAGGG + Intronic
902776307 1:18676924-18676946 GGGAAAATGCAGCTCAGAGAGGG + Intronic
903189365 1:21648188-21648210 GGTCAACTGAAGCCCAGAGAGGG + Intronic
903461574 1:23524585-23524607 GGTAAACTGAGGCACAGAGGTGG - Intronic
904623195 1:31787929-31787951 AGAAAACTGAGCCACAGAGAGGG + Intergenic
905258683 1:36702215-36702237 GGGAAACTGAAGCTCAGAGAAGG - Intergenic
906719316 1:47994171-47994193 GGTAAACTCGCTCACAGAGAGGG - Exonic
907075958 1:51578554-51578576 GGGAAACTGAAACCCAGAGAAGG + Intronic
907424676 1:54372176-54372198 GGAGAACTGAGCCACAGAGAAGG - Intronic
907527795 1:55063814-55063836 GGTGAAATGCCCCACAGTGAGGG - Exonic
907838723 1:58135943-58135965 AGTACACTGCACCGCAGAGAGGG - Intronic
908450761 1:64252285-64252307 AGTCAACTGAACCACAGAGATGG - Intronic
908703492 1:66925768-66925790 GGAAAACTGAAGCCCAGAGAGGG - Intronic
911125396 1:94336806-94336828 AGAAAACTGAAGCACAGAGAGGG + Intergenic
912510198 1:110184543-110184565 GGAAAACTGAAGCACAGAAAGGG + Intronic
912887287 1:113488576-113488598 GGGAAACTGCAACATAGGGAGGG - Intronic
918298873 1:183184386-183184408 GGTGAATTGCACAACAAAGATGG + Intergenic
918450515 1:184653185-184653207 GGAAAACTGAAGCCCAGAGAAGG - Intergenic
919801169 1:201355474-201355496 GGGGAACTTCAGCACAGAGAAGG + Intergenic
921419701 1:214932082-214932104 AGTAAACTGAAACTCAGAGAGGG + Intergenic
921990158 1:221357317-221357339 GGCAAACTACACCACCAAGAAGG - Intergenic
921997528 1:221437447-221437469 GGCAAACTACACCACCAAGAAGG + Intergenic
923195471 1:231662353-231662375 AGTCCACTGAACCACAGAGATGG + Intronic
1062813840 10:484900-484922 TGTAGACTGCAGCACAGTGAAGG - Intronic
1063650531 10:7932330-7932352 TGTACAGTCCACCACAGAGAGGG + Intronic
1065227427 10:23558734-23558756 CTAAAATTGCACCACAGAGAGGG - Intergenic
1069360231 10:67633269-67633291 AGTCCACTGAACCACAGAGATGG - Intronic
1069928338 10:71866364-71866386 GGGAAACTGAGGCACAGAGAAGG - Intergenic
1070047425 10:72852622-72852644 TCTAAATTGCATCACAGAGAGGG + Intronic
1070484839 10:76920402-76920424 AGGAAACTGAAGCACAGAGAAGG + Intronic
1070736782 10:78868419-78868441 AGTAAACTGAAGCACATAGAGGG + Intergenic
1071918550 10:90324235-90324257 GGGAAACTGCGCCACAGAGAGGG + Intergenic
1073108601 10:101047636-101047658 GGGAAACTGAGTCACAGAGAAGG + Intergenic
1073227464 10:101935044-101935066 GGTGAACTGCAGCACAGTAAAGG - Intronic
1075208785 10:120472789-120472811 CTTAAACTGAGCCACAGAGAGGG - Intronic
1075258360 10:120943237-120943259 GGAAAACTGCAGCCCAGAGAGGG + Intergenic
1075343487 10:121665291-121665313 GGGAAACCACAGCACAGAGAGGG - Intergenic
1075835542 10:125449744-125449766 GGAAAAGTGCACCTCTGAGAAGG - Intergenic
1076585014 10:131541092-131541114 GGCTCACTGCACCACAGATATGG - Intergenic
1076834720 10:133015216-133015238 GGAAAACTGCAACAGAGACAAGG - Intergenic
1078977804 11:16497341-16497363 GGTATACTAAACCACAAAGATGG + Intronic
1079116761 11:17645186-17645208 GGAAAACTGAAGCTCAGAGAGGG + Intronic
1079252788 11:18799322-18799344 AGGAAACTGAAGCACAGAGAGGG + Intergenic
1080710936 11:34747572-34747594 AGGAAACTGAAGCACAGAGAAGG + Intergenic
1081650581 11:44821247-44821269 GGGAAACTGAAGCACAGAGAGGG + Intronic
1081660989 11:44888293-44888315 GGTAAACTGAGGCTCAGAGAAGG - Intronic
1081703236 11:45164901-45164923 GGTAAACTGAGGCTCAGAGAGGG + Intronic
1081797747 11:45833247-45833269 AGGAAACTGCAGCTCAGAGAAGG + Intergenic
1082775805 11:57243630-57243652 GGGAAACTGCCCCACAGAGAGGG - Intergenic
1083759769 11:64809514-64809536 GGGAAACTGAAGCCCAGAGAGGG - Intronic
1083857467 11:65400258-65400280 GGTAATCTGCCCCACAGGGCTGG - Intronic
1084044832 11:66562532-66562554 GGGAAACAGCACTACAGAAACGG + Intronic
1084550269 11:69836850-69836872 GGTAAACTGAGGCCCAGAGAGGG - Intergenic
1085380642 11:76114497-76114519 GGAAAACTGAACCCCAGAAAGGG - Intronic
1087651486 11:100873755-100873777 AGTAAACTGAGCCACAGAAAGGG + Intronic
1090240500 11:125178151-125178173 GGGAAACTGAAGCTCAGAGAAGG + Intronic
1094694938 12:32809125-32809147 AGTTGACTGAACCACAGAGATGG + Intronic
1097455285 12:59792521-59792543 AGTCAACTGAACCACAGAGATGG + Intergenic
1097544942 12:60986846-60986868 TGAAAACAGCACCAAAGAGATGG - Intergenic
1099361806 12:81711736-81711758 GAGAAGCTTCACCACAGAGACGG - Intronic
1099411895 12:82340407-82340429 GGTAAACTGGGGCACAGAAAAGG + Intronic
1100197166 12:92260116-92260138 TTTAAACCACACCACAGAGAAGG + Intergenic
1101819355 12:108171796-108171818 GGTACACTGAAGCCCAGAGAAGG - Intronic
1101941193 12:109100276-109100298 GGAAAACTGGATCACAGAGGTGG - Intronic
1102081305 12:110100285-110100307 GGAAAACTGAGGCACAGAGAGGG - Intergenic
1102150805 12:110688364-110688386 GGTAAACGCCAAGACAGAGAGGG - Exonic
1104962658 12:132495565-132495587 GGGAAACTGAGGCACAGAGAGGG + Intronic
1105690821 13:22838032-22838054 GGTATACTGCAACACTCAGATGG - Intergenic
1105768138 13:23580551-23580573 GTGAAACTGCACCACAGAAAAGG - Intronic
1106058278 13:26259947-26259969 GGTATATGGCAACACAGAGAAGG + Intronic
1106160358 13:27195810-27195832 GGGAAACTGAGGCACAGAGAAGG - Intergenic
1106383402 13:29262230-29262252 GGGAAACTGAATCATAGAGAAGG + Intronic
1106387594 13:29302688-29302710 AGTCAACTGAACCACAGAGATGG - Intronic
1108323439 13:49307586-49307608 GGAAACTTGGACCACAGAGAGGG - Intergenic
1111215261 13:85133060-85133082 GAAGCACTGCACCACAGAGAGGG + Intergenic
1113801996 13:113091553-113091575 GGCAAACTGTGCCACAGGGAAGG - Intronic
1117126636 14:52634921-52634943 GGTAAACTGCAACAAAAAAAAGG - Exonic
1117641036 14:57799630-57799652 AGTCTACTGAACCACAGAGATGG - Intronic
1118254536 14:64193894-64193916 GGGAAACTGCAGCTCAGAGAAGG + Intronic
1121699717 14:95943492-95943514 GGGAAACTGAACCTCAGATAGGG - Intergenic
1126733915 15:51712654-51712676 GGTAAAGGGCATCACAGAGTAGG + Intronic
1129128091 15:73463290-73463312 ATTAAACTGCACCACAGAGATGG - Intronic
1129558702 15:76542168-76542190 GATAAATTGCAGCCCAGAGAAGG + Intronic
1129606259 15:77026512-77026534 GGGAAACTGAGGCACAGAGATGG - Intronic
1129753601 15:78082814-78082836 GGAAAACTGCAGCCCAGAGAGGG - Intronic
1130959300 15:88649126-88649148 GGAAAACTGAAGCCCAGAGAGGG + Intronic
1131564814 15:93476575-93476597 GGTAAATTGAACCAAAGAGACGG - Intergenic
1131590923 15:93747238-93747260 AGTCAACTGAACCACAGAGATGG - Intergenic
1131642117 15:94303797-94303819 TGGAAAAAGCACCACAGAGAAGG - Intronic
1132599083 16:765940-765962 GGTAAACTGAGGCACAGGGAGGG + Intronic
1134046330 16:11103766-11103788 GGCAAAGAGGACCACAGAGATGG - Intronic
1135467463 16:22699451-22699473 GGGAAACTGAGGCACAGAGAAGG - Intergenic
1136112988 16:28076577-28076599 GGTAAATAGCATCACAGAGCCGG + Intergenic
1136254619 16:29029738-29029760 GGCAAACTGAGGCACAGAGAAGG - Intergenic
1136666660 16:31818807-31818829 GGGAAACCACACCACAGATATGG + Intergenic
1137346120 16:47661755-47661777 GGTATACTGCTCAAAAGAGAAGG + Exonic
1137718310 16:50612323-50612345 GGAAAACTGAAGCCCAGAGAGGG + Intronic
1138044288 16:53704505-53704527 GGTAAACTGAGGCACAGGGATGG - Intronic
1138270445 16:55692179-55692201 GGGAAGCTGCACCTCAGACAGGG - Intronic
1138579628 16:57932296-57932318 GGGAAACTGAAGCTCAGAGAGGG - Intronic
1138717898 16:59045239-59045261 TGAAAATTGCAACACAGAGAGGG + Intergenic
1140351946 16:74270859-74270881 TGCAAACTGCCTCACAGAGAAGG + Intergenic
1141468823 16:84224771-84224793 TGGAAACTGAAGCACAGAGAGGG + Intronic
1141468898 16:84225331-84225353 TGGAAACTGAAGCACAGAGAGGG - Intronic
1141935048 16:87232746-87232768 GGGAAACTGAGGCACAGAGAGGG - Intronic
1143013966 17:3881900-3881922 GGGAAACTGAGGCACAGAGAAGG + Intronic
1143726497 17:8850462-8850484 GGGAAACTGAAACACAGAGAGGG + Intronic
1144833085 17:18142600-18142622 GGGAAACTGGAGCTCAGAGAGGG - Intronic
1144836625 17:18159714-18159736 GGGAAACTGAACCACAGAGCAGG - Intronic
1145393301 17:22473932-22473954 AGTAAACTGCACAAAAAAGAGGG - Intergenic
1145974280 17:28975408-28975430 GGTAAACTGAGGCACAGAGAAGG + Intronic
1148226207 17:45899481-45899503 GGGAAACTGAAGCACAGAGAGGG + Intronic
1148579696 17:48735016-48735038 GGAAAACTGAGGCACAGAGAGGG - Intergenic
1149190351 17:54054125-54054147 GGTCCACTGCACCATAGAGTGGG + Intergenic
1150696736 17:67411876-67411898 GGGAAACTGAGGCACAGAGAGGG + Intronic
1152856094 17:82665147-82665169 TGTAATCTGCACCCCAGAGGTGG - Intronic
1153475002 18:5489348-5489370 TGTCAACTTCACCACTGAGATGG + Intronic
1156283453 18:35665325-35665347 AGAAAAATGCACCAAAGAGATGG + Intronic
1156509942 18:37627893-37627915 GGTGAGCAGCACCACAGAGTGGG + Intergenic
1157067885 18:44373595-44373617 AGTAGACTGAACCACACAGATGG + Intergenic
1157258226 18:46157103-46157125 GAAAAACAGCAGCACAGAGAAGG + Intergenic
1157286011 18:46377955-46377977 GGTGGACTGCACAACAGAGGTGG + Intronic
1157644320 18:49251705-49251727 GGGAAACTGCTGCATAGAGAAGG + Intronic
1158031127 18:52966454-52966476 GGGATACTGCACAGCAGAGATGG - Intronic
1158406120 18:57161213-57161235 TGTAAACAGCACCAAAGGGATGG + Intergenic
1158486990 18:57876400-57876422 TGTCAACTGGACCACAGAGCTGG + Intergenic
1159038319 18:63298571-63298593 GGTAAATTACACAACAGAGAAGG + Intronic
1160867074 19:1260727-1260749 GGTAAACTGAGGCACAAAGAGGG + Intronic
1162181218 19:8870450-8870472 GGGAAACTGAGGCACAGAGAAGG - Intronic
1162575320 19:11495717-11495739 GGCAAACTGCTCCATAAAGAGGG + Intronic
1163182884 19:15616572-15616594 GGAAAACTCCAGCCCAGAGATGG - Intronic
1163235925 19:16030563-16030585 GGAACACAGCACCACAGGGAGGG + Intergenic
1163452964 19:17390142-17390164 GGTAAACTGAAACCCAAAGAGGG + Intergenic
1163514312 19:17753987-17754009 GGTAAACTGAGGCACAGAGAGGG + Intronic
1164588140 19:29490421-29490443 GGGAAACTGAAGCCCAGAGAGGG + Intergenic
1165809715 19:38605174-38605196 GGGAAATTGAAGCACAGAGAGGG - Intronic
1165957082 19:39507669-39507691 GGCCAACTGCACCACGGAGATGG - Intronic
1166119188 19:40674732-40674754 GGCAAACTGGAGCCCAGAGAGGG - Intronic
1166340713 19:42135039-42135061 GGGGAACTGAGCCACAGAGAGGG - Intronic
1166588118 19:43969203-43969225 AGTAGACTGAACCACAGAAATGG - Intronic
1166658271 19:44627841-44627863 GGCAAACTGAGGCACAGAGAAGG - Intronic
1166899108 19:46044529-46044551 AGTCTACTGAACCACAGAGATGG - Intronic
1167641453 19:50684758-50684780 GGAAATCTGCACCACTGTGATGG - Intronic
926121192 2:10242017-10242039 GGGAAACTGAGGCACAGAGAGGG - Intergenic
926223397 2:10951012-10951034 GGTAATCTGCTCCTCTGAGAGGG - Intergenic
926625712 2:15088052-15088074 GGTGAGCTGCACCACATAAATGG + Intergenic
931756677 2:65381032-65381054 GGGAAACTGCTGCCCAGAGAAGG + Intronic
934038079 2:88105259-88105281 AGAAAACTGAAGCACAGAGAGGG - Intronic
934724753 2:96608809-96608831 GGGAATCAGCACCACAGAGTTGG - Intronic
935929957 2:108113543-108113565 AGTCTACTGAACCACAGAGATGG + Intergenic
939889619 2:147721167-147721189 AGTAAACTGCAACAGAGAAAAGG + Intergenic
940658924 2:156522448-156522470 GGTCAACTGAACCACAGAATGGG - Intronic
941396895 2:164984261-164984283 AGGAAACTTCACCACAGAGCAGG - Intergenic
944850343 2:203712950-203712972 GGGAAACTGAAGCACAGAGTGGG + Intronic
948543633 2:238708873-238708895 TCTAAACTGAAACACAGAGAAGG - Intergenic
948557645 2:238824662-238824684 GTACATCTGCACCACAGAGAAGG - Intergenic
948568835 2:238904594-238904616 GGTAGACTCTACCACAGAAAGGG - Intronic
948666769 2:239539741-239539763 GGTAGCCAGCACCACAGTGAAGG + Intergenic
1171117301 20:22535998-22536020 AGTAAACTGAAGCTCAGAGAGGG - Intergenic
1172020519 20:31910604-31910626 GGAAAACTGGAGCACAGAGAAGG - Intronic
1172586129 20:36086222-36086244 GGGAAACTGAAGCTCAGAGAAGG - Intergenic
1172742516 20:37179755-37179777 GGGAAACTACAGCACAAAGAAGG - Intronic
1172876634 20:38168310-38168332 GGAAAACTGAAACCCAGAGAGGG - Intergenic
1174048705 20:47752304-47752326 AGTAAACTGAGGCACAGAGAGGG + Intronic
1174362347 20:50036963-50036985 AGAAAACTGCAGCTCAGAGAGGG - Intergenic
1174405004 20:50297106-50297128 GGGAAACTGAAGCCCAGAGAAGG + Intergenic
1175268361 20:57716176-57716198 GGTAAACTGAGGCCCAGAGAGGG + Intergenic
1175662908 20:60832338-60832360 GCTAAACTACACCACAGATGTGG - Intergenic
1176522926 21:7838350-7838372 AGTCAACTGAACCGCAGAGATGG - Intergenic
1178575643 21:33786971-33786993 GGGAAACTGAAGCACAGAGCTGG - Intronic
1178656946 21:34468362-34468384 AGTCAACTGAACCGCAGAGATGG - Intergenic
1179916016 21:44478780-44478802 GGTAAACTGAGGCACAGGGATGG + Intergenic
1180193284 21:46179452-46179474 GGTAAATAGCACCACAAAAAAGG - Intronic
1180353685 22:11822923-11822945 AAAAAACTGCACCACAGAGAAGG - Intergenic
1181775904 22:25160162-25160184 AGTAAACTGAGGCACAGAGAAGG + Intronic
1181983442 22:26782598-26782620 GGTAAACTGAGACCCAGAGAGGG + Intergenic
1181994402 22:26863989-26864011 GGAAAACTGAGGCACAGAGAGGG + Intergenic
1183060687 22:35334715-35334737 GGGAAACTGAGGCACAGAGAGGG + Intronic
1183387852 22:37525355-37525377 GGCAAACTGAGGCACAGAGAGGG - Intergenic
1183459366 22:37940692-37940714 GGAACTCTGCAGCACAGAGAGGG - Exonic
949300485 3:2577880-2577902 GGTAAACTGCACCACAGAGATGG - Intronic
950110225 3:10413980-10414002 GGGAAACTGTAGCTCAGAGAAGG - Intronic
951651589 3:24956880-24956902 GGAAAGCTGGACCAGAGAGAAGG + Intergenic
952173461 3:30835400-30835422 GGTTGGCTGCACCACAGATATGG + Intronic
952839211 3:37630193-37630215 TGTAGACTGAACCACAGAGAAGG + Intronic
954700241 3:52447055-52447077 GGAAAACTGAAGCCCAGAGAAGG - Intergenic
954971977 3:54658970-54658992 GGCAAAGTGCCCCAGAGAGAGGG - Intronic
956702657 3:71972324-71972346 GGTAACCTGCAGCAGAGTGAGGG - Intergenic
958917090 3:100061746-100061768 AGAAAACTGAAGCACAGAGAAGG + Intronic
959974787 3:112446597-112446619 CATAAATTGCACAACAGAGATGG + Intergenic
961684797 3:128622361-128622383 GGTAGCCTGCATCACAGAGCAGG - Exonic
961934457 3:130568803-130568825 GGTAAATAGCACTACAGTGATGG + Intronic
961960404 3:130848592-130848614 GGTAAACTAAAGCTCAGAGAAGG - Intergenic
962852423 3:139318106-139318128 GTCAAAATGCATCACAGAGATGG + Intronic
963755993 3:149235491-149235513 AGTTGACTGAACCACAGAGATGG - Intergenic
964288587 3:155149635-155149657 AATAAACTGCACCACCAAGAGGG + Intronic
964364859 3:155939447-155939469 GGAACACTGCTCCACTGAGAAGG + Exonic
965012965 3:163120382-163120404 GGTAAAATTCACCACTAAGAAGG + Intergenic
967436885 3:189457546-189457568 GGTCAACTCCACCGCAGAGAGGG + Intergenic
969336914 4:6516429-6516451 AGCAAGCTGCACCTCAGAGAGGG + Intronic
969638217 4:8381764-8381786 GGGAAACTGAAGCACAGGGAGGG + Intronic
969993548 4:11289058-11289080 TGTAAGCTGCACCAAAGAGCTGG + Intergenic
970178990 4:13368448-13368470 TGTTAACTGAACTACAGAGATGG + Exonic
971451231 4:26803894-26803916 GGTAAACTGCAGCAAAGAGAAGG + Intergenic
971545730 4:27883067-27883089 GGTGAACTGCTCCACGCAGAAGG + Intergenic
974899696 4:67982071-67982093 AGTCAGCTGAACCACAGAGATGG + Intergenic
975892591 4:79047056-79047078 AGTAAACTGAGACACAGAGAGGG - Intergenic
977358738 4:95978812-95978834 AGTAAACTAAAACACAGAGAGGG + Intergenic
978453193 4:108859483-108859505 GATAAACTGGGGCACAGAGAAGG + Intronic
980107358 4:128600547-128600569 TGCAAACTGCAGCACAGAGGAGG - Intergenic
980738636 4:136922194-136922216 GGGAAACTGCACCATTGAAATGG + Intergenic
981059497 4:140406701-140406723 GGAAAATTGTAACACAGAGAAGG - Intronic
981407314 4:144386338-144386360 GGTAATTTGTACCACAGAGAAGG - Intergenic
981882821 4:149636181-149636203 GACAAACTCCTCCACAGAGATGG + Intergenic
982549497 4:156779914-156779936 AGTCAACTCCACCACAGAGCAGG + Intronic
983934224 4:173488740-173488762 GGAAAAATACACCACTGAGAGGG - Intergenic
984548810 4:181136790-181136812 GGTAGCCTTCACCACAGAGTTGG + Intergenic
985387010 4:189458657-189458679 AGGAAACTGAGCCACAGAGATGG - Intergenic
986161128 5:5230128-5230150 GTTCAATGGCACCACAGAGATGG + Intronic
988822661 5:34902785-34902807 GTTAATAAGCACCACAGAGAAGG - Intergenic
991986847 5:72297218-72297240 GTTAAACTGCAGCAGAGTGATGG - Intronic
992259067 5:74952044-74952066 AGTAACCTTCACCACACAGATGG + Intergenic
992667190 5:79021927-79021949 AGGAAACTGAAGCACAGAGAGGG - Intronic
995014128 5:107290744-107290766 GGAAAACTGAGCCACAGAGTGGG - Intergenic
995689378 5:114806498-114806520 GGCAAAATGCACCACATAGAAGG + Intergenic
998300247 5:141011262-141011284 GGAAAACTAAACCAAAGAGAAGG - Exonic
998890705 5:146742815-146742837 GGGAAACTGAAACACAGAGATGG + Intronic
999153585 5:149442451-149442473 GGGAAACTGAGCCCCAGAGAAGG - Intergenic
1000970417 5:167708360-167708382 GTGAAACTGCACCATATAGATGG + Intronic
1001476515 5:172054689-172054711 GGAGAACTGCACCAGAGAGAGGG + Exonic
1001916760 5:175568147-175568169 GGTAAACAGCACCACCTAGTAGG + Intergenic
1002339904 5:178509050-178509072 GGGAAACTGAATCCCAGAGAGGG - Intronic
1003527584 6:6910898-6910920 AGGAAACTGCAGCACAGAGAAGG + Intergenic
1004917930 6:20349226-20349248 GATAAACAGCACCACTGAAAGGG + Intergenic
1006591670 6:35162532-35162554 GGGAAACTGAAGCACAGAGCTGG - Intergenic
1007632267 6:43279086-43279108 GGGAAACTGAGGCACAGAGAGGG - Intronic
1007691737 6:43706878-43706900 GGGAAACCGCAGCACAGAGCAGG - Intergenic
1010867005 6:80988845-80988867 GTTAAACTCTACTACAGAGAAGG + Intergenic
1011916095 6:92508669-92508691 AGTCTACTGAACCACAGAGATGG - Intergenic
1012163285 6:95915645-95915667 GGAAAACTGGACTATAGAGAGGG - Intergenic
1012384171 6:98658554-98658576 GATAATCTTCACCACAGAGCTGG + Intergenic
1012418888 6:99039944-99039966 GGGCTACTGAACCACAGAGATGG + Intergenic
1012524421 6:100160323-100160345 CATAAATTGCACCACAGAGATGG + Intergenic
1013150730 6:107443652-107443674 GGTAGACTGCACCACACGGTGGG - Intronic
1013328425 6:109071447-109071469 GATAAACTGAAGCTCAGAGATGG + Intronic
1013572694 6:111445665-111445687 GTTATACTGCAAGACAGAGATGG + Intronic
1015000002 6:128202671-128202693 AGTTGACTGAACCACAGAGATGG - Intronic
1015901964 6:138076518-138076540 AGTCTACTGAACCACAGAGATGG - Intergenic
1017103048 6:150865570-150865592 GGTAAGCTGTACCAGACAGAGGG - Exonic
1018030206 6:159835718-159835740 GGTAAACAGCACATGAGAGAAGG + Intergenic
1018396166 6:163379606-163379628 GGGAAGCTGGGCCACAGAGAGGG - Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1021141024 7:17025570-17025592 GGTAAATTCCAGGACAGAGATGG - Intergenic
1022534071 7:31084976-31084998 GGGAAACTTCACTCCAGAGAGGG + Intronic
1023794985 7:43784436-43784458 GGGAAACTGCAAATCAGAGATGG - Intronic
1026464681 7:70643965-70643987 GGTCTACTGCAGCACAGATATGG - Intronic
1028774521 7:94662267-94662289 GGTAAACTGCAAGACAAATAAGG + Intronic
1030855045 7:114545197-114545219 GGAAAACTGAATCCCAGAGAGGG - Intronic
1030927555 7:115477219-115477241 TGTAAACTTCACCACCGAGGTGG + Intergenic
1033134518 7:138773576-138773598 GGTCAACAGCACCACAAAGTGGG + Intronic
1034260007 7:149749330-149749352 GGAAAGCTGGTCCACAGAGAAGG + Intergenic
1035528373 8:332433-332455 AGTATAATGCACCACAGAAAAGG - Intergenic
1036171078 8:6485427-6485449 TGTAAACTTCAGCACACAGAAGG - Intronic
1037577381 8:20220479-20220501 GGTAAACTCCAACACAAAGGTGG - Exonic
1039896758 8:41722136-41722158 AGGAAACTGAAACACAGAGAGGG + Intronic
1039924739 8:41919213-41919235 GGTAAACACCACCACAGGGATGG - Intergenic
1041444382 8:57934034-57934056 AGGAAACTGAAGCACAGAGAAGG + Intergenic
1043395670 8:79833503-79833525 GATCAACTGCACAACAGAGCAGG + Intergenic
1045595550 8:103650777-103650799 AGTCTACTGAACCACAGAGATGG + Intronic
1048372814 8:133794477-133794499 GGTAGTTTGCATCACAGAGAGGG - Intergenic
1048414301 8:134209259-134209281 GGTACACTGAATGACAGAGATGG - Intergenic
1049201871 8:141344244-141344266 GGGAAACTGCGGCCCAGAGAGGG + Intergenic
1052654818 9:31343975-31343997 AGTAAAGTTGACCACAGAGAAGG + Intergenic
1053464308 9:38294012-38294034 GGAAAACTGAAGCCCAGAGAGGG + Intergenic
1053613178 9:39735714-39735736 TGTTAACTGAACTACAGAGATGG - Intergenic
1053871222 9:42493657-42493679 TGTTAACTGAACTACAGAGATGG - Intergenic
1054240337 9:62606688-62606710 TGTTAACTGAACTACAGAGATGG + Intergenic
1054554470 9:66641214-66641236 TGTTAACTGAACTACAGAGATGG + Intergenic
1055605152 9:77961559-77961581 GGTTCACTGCACCACAAAGAAGG + Intronic
1055842260 9:80519403-80519425 AGTTAACTGAACCGCAGAGATGG + Intergenic
1057158644 9:92868422-92868444 GGAAAACTGTTACACAGAGAAGG - Intronic
1057474294 9:95385579-95385601 GGTATCCTGCACCACAGAAGAGG + Intergenic
1058704305 9:107626022-107626044 GGGAAACTGAGCCACAGAGAAGG - Intergenic
1059076351 9:111197435-111197457 AGTCAACTGAACCACAGAGATGG - Intergenic
1059464459 9:114458964-114458986 AGTAAACTGAAGCTCAGAGAGGG + Intronic
1059648396 9:116290511-116290533 GGGAAACTGCAGCCCAGAGAGGG + Intronic
1060018175 9:120105215-120105237 GGTGAACTGAAGCACAGAGAGGG - Intergenic
1060294613 9:122334784-122334806 GGGATACTGAAGCACAGAGAGGG + Intergenic
1060551353 9:124486905-124486927 AGGAAACTGCAGCTCAGAGAGGG - Intronic
1061283692 9:129610772-129610794 GGTAAACTGAGGCTCAGAGAGGG + Intronic
1062265100 9:135683390-135683412 GGGAAACTGAGGCACAGAGAGGG - Intergenic
1062318838 9:135980734-135980756 GGGAAACTGAGGCACAGAGAAGG + Intergenic
1186672986 X:11785762-11785784 TTTAAACTGTTCCACAGAGAGGG - Intergenic
1187311605 X:18149457-18149479 CATAAACTGCACCACAGAGTTGG - Intergenic
1187646091 X:21348633-21348655 AGTTGACTGAACCACAGAGATGG - Intergenic
1188127685 X:26390743-26390765 GGGAAACTGCAGGACAGAGAAGG - Intergenic
1189861392 X:45276077-45276099 AGTCAACTGAACTACAGAGATGG + Intergenic
1191885403 X:65882927-65882949 AGGAAACTGAACCTCAGAGAAGG + Intergenic
1193021500 X:76797965-76797987 GGGAATCTGCACCATAAAGAAGG + Intergenic
1193844832 X:86455654-86455676 CGTTTACTGAACCACAGAGAGGG + Intronic
1197776751 X:130123103-130123125 GGTAAACAGCAACTGAGAGATGG + Intergenic
1198428466 X:136542676-136542698 AGGAAACTGCAGCCCAGAGAAGG + Intronic
1198459307 X:136848122-136848144 TGTTAACTGAACTACAGAGATGG - Intronic
1199045775 X:143169885-143169907 AATAAACTGCAGCACAAAGAGGG - Intergenic
1199784949 X:151096681-151096703 GGGAAACTGAAGCACAGGGAAGG - Intergenic
1199977260 X:152901631-152901653 GGGAAACTGAGGCACAGAGAGGG + Intergenic