ID: 949303273

View in Genome Browser
Species Human (GRCh38)
Location 3:2609305-2609327
Sequence CCTCACATGGTGAAGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 2, 1: 5, 2: 11, 3: 63, 4: 310}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949303273_949303282 17 Left 949303273 3:2609305-2609327 CCTTCTGCCTTCACCATGTGAGG 0: 2
1: 5
2: 11
3: 63
4: 310
Right 949303282 3:2609345-2609367 CCACCTTGGAAGCAGTGAGTGGG 0: 1
1: 0
2: 4
3: 53
4: 328
949303273_949303280 16 Left 949303273 3:2609305-2609327 CCTTCTGCCTTCACCATGTGAGG 0: 2
1: 5
2: 11
3: 63
4: 310
Right 949303280 3:2609344-2609366 GCCACCTTGGAAGCAGTGAGTGG 0: 1
1: 0
2: 4
3: 76
4: 261
949303273_949303279 3 Left 949303273 3:2609305-2609327 CCTTCTGCCTTCACCATGTGAGG 0: 2
1: 5
2: 11
3: 63
4: 310
Right 949303279 3:2609331-2609353 CGGTATTCAAGGTGCCACCTTGG 0: 1
1: 0
2: 10
3: 39
4: 183
949303273_949303278 -8 Left 949303273 3:2609305-2609327 CCTTCTGCCTTCACCATGTGAGG 0: 2
1: 5
2: 11
3: 63
4: 310
Right 949303278 3:2609320-2609342 ATGTGAGGACACGGTATTCAAGG 0: 1
1: 0
2: 12
3: 33
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949303273 Original CRISPR CCTCACATGGTGAAGGCAGA AGG (reversed) Intronic
900728679 1:4236528-4236550 ACTCACATGGTGGAAGCAGTAGG - Intergenic
900874175 1:5329802-5329824 CCTCACATGGTGGAAGGGGAAGG + Intergenic
900893587 1:5467171-5467193 CCTCACATGGGGCTGGCAGATGG - Intergenic
900924728 1:5697577-5697599 CTTCACAGAGTGAAGGCGGAAGG - Intergenic
901741757 1:11346340-11346362 CCTCACCTGGGCCAGGCAGAGGG - Intergenic
902108282 1:14056322-14056344 TCTTCCATGATGAAGGCAGAAGG + Intergenic
902939205 1:19787607-19787629 CATCAGATGGGGAAGGGAGATGG + Intronic
903811698 1:26038329-26038351 CCTGACATGGTGGAGGGAAAGGG - Exonic
903857750 1:26346641-26346663 CCCCACATGGAGGAGGCAGGTGG - Exonic
904380749 1:30109140-30109162 CATCACATGGCCAGGGCAGAGGG - Intergenic
905011384 1:34749248-34749270 CCTCACGTGGCAGAGGCAGAAGG - Intronic
906192622 1:43907705-43907727 CCTGAGAAGGTGAAGGGAGATGG - Intronic
907048460 1:51314189-51314211 CATCACATGGAGAAGGCAACAGG + Intronic
907480831 1:54744650-54744672 CCACACCTGGGGAGGGCAGAGGG + Intergenic
907480930 1:54745139-54745161 CCACACCTGGGGAGGGCAGAGGG - Intergenic
908454666 1:64291469-64291491 CCTCACATGGTGGAGAGAGAGGG + Intergenic
909039281 1:70630219-70630241 CCTTAAATGGTGAAGGCTCAGGG - Intergenic
910101707 1:83584156-83584178 TCTCACATGGTAGAGACAGAGGG + Intergenic
913348218 1:117829138-117829160 CCTTACATGGTGAAAGAACAAGG + Intergenic
915643231 1:157246128-157246150 AGTCACAAGGTGAAGGCAGAAGG - Intergenic
915922903 1:159990510-159990532 CCTCATATGGGGAAGGGAGAGGG - Intergenic
918414115 1:184289333-184289355 CCTTAGATGGTGAAGGCTCAGGG - Intergenic
918861488 1:189831993-189832015 CCTTATAAGATGAAGGCAGAGGG - Intergenic
919539116 1:198827476-198827498 CAGCAGATGGTGAAGCCAGAAGG + Intergenic
920853292 1:209643725-209643747 CCTCCCATGAGGAAGCCAGAGGG + Intronic
921174938 1:212585448-212585470 CCTCTGATGGTGAAGCCTGAAGG - Intronic
922170710 1:223152156-223152178 CCTCACATGGCAAAAGCAGGAGG - Intergenic
922492587 1:226030085-226030107 CCTCAGATGGTGGATTCAGAAGG - Intergenic
924672790 1:246146868-246146890 CCTCCCTTGGTGAAGGTTGATGG + Intronic
924897187 1:248352823-248352845 CCTCACAAGGGGAAGACAGAAGG + Intergenic
1064245046 10:13661494-13661516 GCTCACATGGTGCACACAGAAGG - Intronic
1064796740 10:19020531-19020553 CCTCACATGGTGGAGAAAGAGGG + Intergenic
1064885903 10:20112046-20112068 CCTCACATGGTATATGCAGATGG - Intronic
1066524523 10:36262000-36262022 TCTCACATGCAGAAGGCAGGAGG - Intergenic
1067731429 10:48814442-48814464 CCTGACTTAGAGAAGGCAGATGG + Intronic
1069182748 10:65383542-65383564 CCTCACATGGCCAGAGCAGAGGG + Intergenic
1070068604 10:73063316-73063338 CCTCACATGGTGAAGGCTGAAGG + Intronic
1070754304 10:78982116-78982138 CCTCACATGCTGCAGGGAGGTGG + Intergenic
1071255645 10:83869563-83869585 TGGCACATGGTAAAGGCAGAGGG - Intergenic
1071342968 10:84665304-84665326 CCTCACATTGCTTAGGCAGAAGG - Intergenic
1071860232 10:89664828-89664850 CCTCACATGGTGGAAGGAGCAGG - Intergenic
1074186423 10:111102754-111102776 ATTCACATGGTCTAGGCAGATGG + Intergenic
1075326350 10:121535050-121535072 CCTCACAAGAGGAAGACAGAAGG + Intronic
1077013494 11:390211-390233 CCTGACATGGTGGAGGAAGGAGG - Intergenic
1077531109 11:3095465-3095487 GCACACATGGTCAGGGCAGAAGG + Intronic
1077998928 11:7477177-7477199 TCTCACATGGTGGAGAGAGAGGG - Intergenic
1079108573 11:17590287-17590309 ACTCAGATGGGGAAGGCTGAGGG - Intronic
1080208449 11:29757078-29757100 ACACAGATGGTGAAGCCAGATGG + Intergenic
1080257346 11:30305849-30305871 CCTCACATGGTGAAAGGCAATGG + Intergenic
1082066383 11:47904100-47904122 CTTCACATGGTGGAGGTGGAGGG - Intergenic
1083864245 11:65445169-65445191 CCTCTGCTCGTGAAGGCAGAGGG + Intergenic
1086373943 11:86181578-86181600 CCTGGCATGTTGAAGGAAGATGG + Intergenic
1086813762 11:91343458-91343480 CCTTACATGGAGAAACCAGAAGG + Intergenic
1088156822 11:106815736-106815758 CCTCACAAGAGGAAGGCAGAGGG + Intronic
1088393262 11:109339483-109339505 CCTCACATAATGAAGAAAGATGG - Intergenic
1090873761 11:130770684-130770706 CCTCACATGGATAAGGCACACGG + Intergenic
1090882946 11:130850202-130850224 CCTCACATGGTGGAGAGAGAAGG - Intergenic
1091896410 12:4108735-4108757 CTTCAGATGGTGATGACAGAAGG - Intergenic
1093288042 12:17290076-17290098 CCTCACATGGTAGAGAGAGAAGG + Intergenic
1093966751 12:25335828-25335850 AATCACAGGGTGAAGGCACAGGG + Intergenic
1094719510 12:33049035-33049057 CTTCACATGGCGAAAGCAGGAGG - Intergenic
1095418833 12:42004119-42004141 ACTTACATGTTGAAGGCAAAAGG + Intergenic
1098387496 12:69934488-69934510 CCTCCACTGGTGAAGGCAAAGGG + Intronic
1098489560 12:71059678-71059700 CCTCACATGATGAAAGCAGCGGG + Intronic
1098940046 12:76523638-76523660 CCTCACATGGTGGAAACAGAGGG - Intronic
1099475738 12:83105524-83105546 CTTCACATGGTGAAAGCAGGAGG + Intronic
1100123696 12:91397740-91397762 CATCCCATGGAGAAGGCAGAAGG + Intergenic
1104081909 12:125436529-125436551 CGTCGCATGAAGAAGGCAGAGGG + Intronic
1105308481 13:19185722-19185744 CATCACATGGTGGAGAGAGAAGG - Intronic
1105577531 13:21668001-21668023 CCACACATGGAGTAGGCAGAGGG + Intergenic
1106367619 13:29097695-29097717 CTTCACATGGTGGAAACAGAGGG + Intronic
1106411684 13:29515275-29515297 CCAGGCCTGGTGAAGGCAGAGGG - Intronic
1106769543 13:32948555-32948577 CCTCCCATGGGGAAGCAAGAAGG - Intergenic
1108352081 13:49596961-49596983 AGTCACATGGTGAAAGCAGGAGG + Intergenic
1108379486 13:49842422-49842444 CCTCACATGGAGAAGGCAGAAGG - Intergenic
1109342081 13:61075241-61075263 TCTCACATGGTGGAAGCAGGAGG - Intergenic
1111715109 13:91869817-91869839 CTTCACATGGTGACAGCAGAGGG + Intronic
1111990172 13:95108575-95108597 CCTCACATGGTGGAAGGTGAAGG - Intronic
1112092058 13:96091785-96091807 TCTTAGAGGGTGAAGGCAGAGGG - Intronic
1113589914 13:111491224-111491246 CCTCAGAAGCTGACGGCAGAAGG + Intergenic
1115140678 14:30167972-30167994 CATCACATGGTGAAAGCAGGAGG + Intronic
1115286142 14:31714518-31714540 CAGCACATGGTGACAGCAGAAGG + Intronic
1115790403 14:36871258-36871280 CCTCACATGGTGAAAGAGCAAGG - Intronic
1117011135 14:51471934-51471956 CCTCACATGGCAGAGGCAGAAGG - Intergenic
1117847368 14:59925398-59925420 ACTCACATGGCCAAGTCAGAAGG + Intronic
1117994645 14:61467342-61467364 CCCCACATGTTGAAGCCAGCTGG - Intronic
1118537422 14:66783268-66783290 CCTCACCTGGTGGTGGCAGCAGG + Intronic
1119181360 14:72607384-72607406 CTTCACATGGTGAAGGGGCAAGG + Intergenic
1119614972 14:76093000-76093022 CCTGAGATGGTGAGGGCTGATGG - Intergenic
1120573307 14:86148740-86148762 CATCTCATGCAGAAGGCAGAAGG + Intergenic
1120624447 14:86807309-86807331 CCTCACATGTGGAAGGCAGAGGG + Intergenic
1121161281 14:91743712-91743734 CCTCCCATGCAGAAGGCAGAAGG - Intronic
1122495847 14:102154371-102154393 CCTCACATGGTGGAGGGGGAAGG + Intronic
1122498873 14:102180779-102180801 CCTCACATGGTTACGACAAAGGG - Intronic
1122517052 14:102316237-102316259 AATCACATGGTACAGGCAGAAGG - Intergenic
1122818064 14:104323791-104323813 CCTCACGTTGGGGAGGCAGATGG + Intergenic
1122866937 14:104610498-104610520 CATCTCATGGTGGAGGCAGAAGG - Intergenic
1122878054 14:104677860-104677882 CCTCCCAAGGAGGAGGCAGATGG + Intergenic
1123049372 14:105533280-105533302 CCCCAGATGGTGAAGAAAGATGG - Intergenic
1123880797 15:24676242-24676264 GCTCACGTGGTGAAGGCAGCAGG - Exonic
1125006370 15:34822256-34822278 CCTCACATGCTGAAGCGGGATGG - Intergenic
1125733297 15:41906551-41906573 CCTGCAATGGTGAGGGCAGAGGG - Intronic
1125772599 15:42179997-42180019 CTTCACATGGTGGAAGGAGAAGG - Intronic
1128336990 15:66793249-66793271 TGTCACATGGTGAAAGCAGGAGG - Intergenic
1128498381 15:68210877-68210899 CCCCAGATGGTGATGGCAGGGGG - Intronic
1130067560 15:80617284-80617306 CCTCATAAGGGGAAGGCAGGAGG - Intergenic
1130921146 15:88345686-88345708 CCTCACATGGTAAAGGAGGAAGG + Intergenic
1132415350 15:101615233-101615255 CCTACCATGGGGAATGCAGAAGG + Intergenic
1133441144 16:5821823-5821845 CCTCACATGGTGAAAGGAGAAGG + Intergenic
1134384338 16:13757943-13757965 CATCCCATGGTGAAAGTAGAAGG - Intergenic
1135778679 16:25279704-25279726 GTTCTCATGGTGATGGCAGAGGG - Intergenic
1135804401 16:25529030-25529052 CCTCATATGGTGCAGGGGGAAGG + Intergenic
1136403245 16:30029745-30029767 CCACAAATGGGGAAGGAAGAAGG - Intronic
1137378227 16:47973287-47973309 CCTCACCTGATGAAGGCTGTTGG - Intergenic
1137595158 16:49718738-49718760 CCTCACATGGTGGAAGGAGCTGG + Intronic
1137773439 16:51036677-51036699 CCTGAGATGGTGATGGCAGGTGG + Intergenic
1137905495 16:52318095-52318117 GCTTCCATGGTGAATGCAGAGGG - Intergenic
1138413948 16:56860542-56860564 CCTGAAATGGTGAGGACAGAAGG - Intergenic
1139336441 16:66235032-66235054 CCTCACATGGTGAAGGGAGAAGG - Intergenic
1140256271 16:73338942-73338964 CATCACGTGGCGAAGGCAGGAGG - Intergenic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1141007374 16:80364899-80364921 CCTCTCATGGTGACGGCAGAGGG - Intergenic
1142128233 16:88420756-88420778 CCTCACAGGGTGTGGTCAGAGGG - Intergenic
1143014728 17:3885590-3885612 ACTCACTTGGAGGAGGCAGATGG - Exonic
1143191784 17:5045210-5045232 CCTCACCAGGTGTAGGCTGAGGG + Intronic
1146414788 17:32621860-32621882 CCTCACATGGGGAAGAGAGGAGG - Intronic
1149009897 17:51845400-51845422 ACTCACATGGCCATGGCAGAAGG - Intronic
1150644686 17:66970606-66970628 GCTCACATGGTGGAGAGAGAGGG + Intronic
1151089091 17:71414685-71414707 TGTCACATGGTGAAAGCAGGAGG + Intergenic
1151745897 17:76011663-76011685 CTTCTCCTGGAGAAGGCAGAGGG + Exonic
1153583061 18:6594726-6594748 CCGCTCATGGGGAAGGCAGAAGG + Intergenic
1156090694 18:33465215-33465237 CATCACATGGAAAAGGCACATGG - Intergenic
1156886245 18:42139675-42139697 CCTCACATGGCAGAAGCAGAAGG + Intergenic
1157332540 18:46714251-46714273 GCTCACAAGGTTAAGGCAGCTGG - Intronic
1158013324 18:52754485-52754507 CCTCACATGGTGAAAGGAGCAGG - Intronic
1158111182 18:53942797-53942819 CCTTAAATGGTGAAGGCTCAGGG + Intergenic
1158206341 18:54997323-54997345 CCTCACCTGCTGAAAACAGAAGG + Intergenic
1158241202 18:55380219-55380241 CCTCACATGGAGAAGAGAGAAGG + Intronic
1159219333 18:65439456-65439478 CCTATCCTGGTTAAGGCAGAGGG + Intergenic
1161314114 19:3609938-3609960 CATCACAAGTTGATGGCAGATGG - Intergenic
1162876324 19:13623516-13623538 CGTCACATGTTCAGGGCAGATGG + Intronic
1163837172 19:19582028-19582050 CCCAACACAGTGAAGGCAGAAGG + Intronic
1163849140 19:19653746-19653768 AGGCACATGGTGAAGGCAGGGGG + Intronic
1164684476 19:30157839-30157861 CCTCACGTGGTGAAGGCAGAAGG - Intergenic
1164709980 19:30349017-30349039 ACTCATTTGGTGGAGGCAGAAGG - Intronic
1164810115 19:31148864-31148886 CCTCACAAGGCTGAGGCAGAAGG - Intergenic
1167636782 19:50659980-50660002 CCTGACATGGTGAGGGGAGGGGG + Intronic
925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG + Intronic
926811557 2:16759405-16759427 CCTCATATGGACAAGGCAGATGG - Intergenic
927123058 2:19986682-19986704 CCTGAGAAGGTGAAGGGAGATGG + Intronic
929907492 2:46058939-46058961 CTTCACAAGGTGAAGGCAAGAGG - Intronic
930468378 2:51781939-51781961 CAACACCTGGTGAAGCCAGAGGG - Intergenic
931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG + Intronic
932323163 2:70836745-70836767 TCTCACATGGTGCAGGAAGCAGG - Intergenic
932718024 2:74116994-74117016 CCTCAAATGGGCAAGGGAGAGGG + Intergenic
932873310 2:75425412-75425434 CCTCCACTGGTGAGGGCAGAGGG + Intergenic
933090206 2:78108757-78108779 CCTTAAATGGTGAAGGCTCAGGG + Intergenic
933669259 2:84991241-84991263 ACTGACATGGGGAAGGCAGGAGG + Intronic
933853648 2:86392875-86392897 CCACAAATGGTGCTGGCAGAAGG + Intergenic
934166801 2:89301454-89301476 CCTCAATTGGTGATGACAGAAGG + Intergenic
934200479 2:89881003-89881025 CCTCAATTGGTGATGACAGAAGG - Intergenic
935277807 2:101490885-101490907 CCTCACATGTAGAAGGCAGAAGG - Intergenic
935942432 2:108254663-108254685 TCTCACATGGTTAGGACAGAGGG - Intronic
937547510 2:123040980-123041002 GTTCAAATGCTGAAGGCAGAAGG + Intergenic
938011579 2:127833001-127833023 CCTTAAATGGTGAAGGCCCAGGG - Intergenic
938248424 2:129796357-129796379 CCTCACATGGGGAGGCCAAATGG - Intergenic
938941207 2:136171069-136171091 CTGCACACGGGGAAGGCAGAGGG + Intergenic
939844955 2:147231604-147231626 CCACACATGGAGAACACAGAAGG - Intergenic
940967255 2:159852906-159852928 CATCCCAGGGTGAAGGCAGGAGG + Intronic
941688345 2:168470614-168470636 ACACACTGGGTGAAGGCAGAAGG - Intronic
943943472 2:194028901-194028923 CCACAGATAGTGTAGGCAGATGG + Intergenic
945866527 2:215182395-215182417 GCTCAGGTGGTGAAGGCAGCAGG + Intergenic
948943850 2:241209668-241209690 CCCCACATGGTGCAGGAGGATGG - Intronic
1169606277 20:7323134-7323156 CCTCACATGGTGGAGGGTGAGGG + Intergenic
1169729680 20:8773133-8773155 CATCACATGGGGAAGGGAGTTGG - Intronic
1170582767 20:17711502-17711524 CCTGACCTGGTGAAGGAAGCAGG + Intronic
1170789615 20:19496984-19497006 ACTCACAAGGAGAAGGCAGAAGG - Intronic
1170920548 20:20674929-20674951 CCTAAAATGGTGAAGGGGGAGGG + Intronic
1170976256 20:21167406-21167428 GCTCAGATGGTGAAGGTATAAGG - Intronic
1171481571 20:25459251-25459273 CACCACATGGTGGAGGAAGAGGG + Intronic
1173293023 20:41730948-41730970 CTTCACATGGTGAAGCCATGAGG - Intergenic
1173317477 20:41958112-41958134 CTTTTCATGATGAAGGCAGAAGG - Intergenic
1173660216 20:44727892-44727914 CCTCACAAGGTGAAATCACATGG + Intronic
1173909650 20:46656874-46656896 CAGCAAATGGAGAAGGCAGAAGG - Intronic
1173958788 20:47055388-47055410 CCACACTGGGTGAAGGCAGATGG + Intronic
1174185056 20:48700698-48700720 CATCACCTGGAGAAGGCAGCAGG + Intronic
1174884012 20:54311816-54311838 CCTCACATTCAGGAGGCAGAAGG + Intergenic
1175004710 20:55669953-55669975 TGTCACATGGTGAAAGCACAGGG - Intergenic
1175828417 20:61949572-61949594 CCTCACATGGTGGAAGGTGAGGG + Intergenic
1176718517 21:10374610-10374632 CCTTACATGGTAAAGGTGGAAGG - Intergenic
1177486043 21:21757573-21757595 CCTCACATGGCAAAGGCAGAAGG + Intergenic
1178047199 21:28709055-28709077 CCTCACATGGTGAAAAGAGCTGG + Intergenic
1180258007 21:46646935-46646957 CCTCACGTGGTGAAGGCGGGAGG + Intronic
1181936273 22:26441174-26441196 CTTCACATGGTGAAAGGAGGTGG + Intronic
1182055003 22:27345644-27345666 CCTCAACTGGAGAAGGAAGAGGG - Intergenic
1182133350 22:27876183-27876205 CCTCACAGGATGATGGCAAAAGG + Intronic
1182150849 22:28026167-28026189 CCTCAGGTGTTGAGGGCAGAGGG + Intronic
1182848175 22:33448656-33448678 ACTGACATGGGGAAGGCTGAGGG - Intronic
1183314157 22:37128088-37128110 ACTCACTTGGTGTAGACAGATGG - Exonic
1184334402 22:43844862-43844884 CCACACCTGGTGCAGGCAGGAGG + Intronic
1184346783 22:43918449-43918471 CCGGTCATGGTGAAGTCAGATGG - Intergenic
1184425060 22:44404338-44404360 CCCCACGTGGGGAAGTCAGAGGG + Intergenic
1185273316 22:49938433-49938455 CCAGACATGGAGAAGGCGGATGG + Intergenic
949303273 3:2609305-2609327 CCTCACATGGTGAAGGCAGAAGG - Intronic
949608176 3:5676902-5676924 TCTCACATGGTGACGGCATGAGG - Intergenic
949635249 3:5975124-5975146 CATTATATGGTGAAAGCAGAAGG - Intergenic
949909317 3:8887970-8887992 CCTGGCATGATTAAGGCAGAGGG - Intronic
949935495 3:9112617-9112639 CCTCTCCTGGGGAAGGCGGAGGG + Intronic
950211148 3:11124482-11124504 CCTCAAATGGAGCAGGCAGGTGG + Intergenic
950609452 3:14116625-14116647 CCTCACATAGGGATGGCATATGG - Intronic
952637772 3:35552542-35552564 CCTAGCATGGTCAAGGCTGAAGG - Intergenic
952989431 3:38818813-38818835 CCTCAGATGGTGAAGGCATTTGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955084383 3:55688455-55688477 GCTCATATGGTGGAGTCAGAAGG - Intronic
955315449 3:57935034-57935056 CCTCAGAAGGTTAAGGCAGGAGG + Intergenic
956765500 3:72481141-72481163 CCTCCCACGCAGAAGGCAGAAGG - Intergenic
956976309 3:74584477-74584499 CGTCACATGGTGAGAGTAGAAGG - Intergenic
957258313 3:77867404-77867426 GCTCACATGGTGGAAGCAGAAGG + Intergenic
958461142 3:94397511-94397533 CTTCACATGGTGAAGACAGAAGG - Intergenic
959515073 3:107256693-107256715 CCACACATGGTGGAAGAAGAGGG + Intergenic
961574176 3:127821739-127821761 CCTCACCTGGTCAATGCAGACGG - Exonic
962082746 3:132157787-132157809 CTGCATATGGGGAAGGCAGAAGG - Intronic
962477895 3:135772813-135772835 TGTCACATGGCGAAAGCAGAAGG + Intergenic
962883587 3:139601857-139601879 CCTACAATGTTGAAGGCAGATGG + Intronic
963088222 3:141457936-141457958 CCACACAAAGTGAGGGCAGAAGG - Intergenic
963229042 3:142891415-142891437 CCTCACAGGGTGATAGGAGAAGG + Intergenic
963713001 3:148768825-148768847 CCTCACATGGTGGAGGGGCAGGG - Intergenic
963989368 3:151635419-151635441 CCTCACATGGTGGAAGGGGAGGG + Intergenic
964341032 3:155708417-155708439 CCTCTCATGGTGTAGCCAGAAGG + Intronic
964368907 3:155978509-155978531 CCTCTGGTGGGGAAGGCAGAGGG - Intergenic
964432760 3:156623436-156623458 CCTTAAATGGTGAAGGCTCAGGG - Intergenic
965928211 3:174009142-174009164 CCTCACATGGTTAAGAGAGAAGG + Intronic
966982219 3:185148260-185148282 CCTCACATGGTGATGTCGGTAGG - Intronic
967123459 3:186404525-186404547 CCTCACATGGTGAAAGGGCAAGG - Intergenic
967386121 3:188912724-188912746 TCTCACATGGTGGGGGCAGGAGG + Intergenic
968842898 4:3021171-3021193 CCTCGCATGATGAGGGCAGGGGG - Intronic
968883798 4:3316441-3316463 CTTCACATGGTGATTGCTGAAGG + Exonic
969837765 4:9857474-9857496 CCTGAGATGGTGAGGGAAGATGG - Intronic
970132708 4:12888761-12888783 CTTCTCATGGTAATGGCAGAAGG + Intergenic
970237711 4:13975402-13975424 CCTCACATGGCGAAAGGGGAAGG + Intergenic
970413749 4:15836284-15836306 CCTTACATGGCAGAGGCAGAGGG + Intronic
971140881 4:23923725-23923747 CCTCAGATGGAAAAGGAAGAGGG + Intergenic
971360885 4:25937386-25937408 CATCCCATGGTGAAGGCAAAAGG + Intergenic
973953185 4:56038057-56038079 CCTACCATGGTGAGAGCAGAGGG + Intergenic
974349353 4:60724456-60724478 CATCACATGGCGAAAGCAGTGGG - Intergenic
974370358 4:61008989-61009011 CCTCACATGCTGAAGGGATGAGG + Intergenic
974466997 4:62270647-62270669 CTTCACATGGTGACAGCAAAGGG - Intergenic
974620574 4:64348378-64348400 CCTCACATGTTGAGGGCGGGAGG - Intronic
975805082 4:78103692-78103714 CCTCACATGGTGAAAGGGGTTGG - Intronic
976397607 4:84572989-84573011 CCTCACATGGTGGAGAGAAAAGG - Intergenic
976542993 4:86299450-86299472 CCTCACCTGATGAAGGAACAAGG - Intronic
976894449 4:90091665-90091687 GATCACATGGTGAAAGCAGGGGG + Intergenic
977378191 4:96236333-96236355 CTTCACATGGTGAAAGCAGGAGG - Intergenic
977823329 4:101501829-101501851 CCTCACATGGTGGAGGGAGAGGG + Intronic
979046332 4:115870298-115870320 CCTCACATGGCCAGAGCAGAAGG - Intergenic
979362854 4:119784630-119784652 CTTCACATGGTGACAGGAGAGGG + Intergenic
979862849 4:125715906-125715928 CTTCACATGGTGAAGGGAAAAGG - Intergenic
979930540 4:126624574-126624596 CCTCACATGGTGGAAGCATAAGG + Intergenic
980057465 4:128092564-128092586 CCTTACAAGGTGAAGGAAAAGGG + Intronic
980185392 4:129454911-129454933 ACACACATGGTAAAGGCAGAAGG - Intergenic
980287433 4:130798646-130798668 ACTCACACGGTAAAGGCATAAGG - Intergenic
980626696 4:135382085-135382107 CTTCTTCTGGTGAAGGCAGAGGG - Intergenic
982101409 4:151971817-151971839 GATCACATGGTGAAAGAAGAAGG - Intergenic
982391045 4:154864063-154864085 CCTCACATGGTGAGAGCAAGTGG + Intergenic
983058047 4:163122775-163122797 CATCACATGGTGAAGGCAGGAGG - Intronic
983382448 4:167014544-167014566 ACTCACAAAGTTAAGGCAGAAGG + Intronic
983871739 4:172831830-172831852 CTTCACATGGTGGAGAGAGAAGG - Intronic
984290867 4:177792282-177792304 CCACTCATGGTAAAGGCAAAGGG + Intronic
986741203 5:10707022-10707044 ACCCACATGGAGAAGTCAGAGGG + Intronic
987774691 5:22349076-22349098 CCTCATATGGTGAAGGGACAAGG - Intronic
988498130 5:31761988-31762010 CCTCACATGGCTAATGCAGGAGG + Intronic
988990977 5:36670857-36670879 TCTCACAAGGTGAAGGGAAAAGG - Intronic
989398848 5:40987481-40987503 CCTCACATGGTGGACAAAGAGGG + Intergenic
989692888 5:44166607-44166629 CTTCACATGGTGACAGTAGAGGG + Intergenic
989703237 5:44296046-44296068 TTTCACATGGTGAAGACAGGAGG + Intergenic
990064213 5:51692601-51692623 CCTCACATGATGGAGAGAGAAGG + Intergenic
990703497 5:58500728-58500750 CCTCACATGGTGCTGGGAGGTGG - Intergenic
991408969 5:66328330-66328352 CCTCCCATGTGGAAGGCAGAAGG - Intergenic
992180193 5:74188508-74188530 ACTCACATGGTGAACGTAGGTGG + Intergenic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
993109892 5:83643870-83643892 ACTCTCAAGGTGAAAGCAGAAGG - Intronic
993559204 5:89382850-89382872 ACTATCATGGTGAAGGCAAAGGG - Intergenic
993860800 5:93134471-93134493 CTTCACTTGGTGCAGGCAGCTGG + Intergenic
994044029 5:95287619-95287641 CCCCACCGGGTGAAAGCAGAAGG + Intergenic
994516306 5:100776656-100776678 CCTCACATAGTGAAGAGAGAGGG - Intergenic
994619296 5:102144451-102144473 CTTTAAATGTTGAAGGCAGATGG - Intergenic
994687546 5:102974395-102974417 CCCCACCTGGTGAAGGCACCTGG + Exonic
994955934 5:106532320-106532342 CATCACGTGGTGAAAGCAGGAGG - Intergenic
996035009 5:118749178-118749200 CCTGACATGGTGAAGAGAGAGGG - Intergenic
998626065 5:143847307-143847329 CCTCACATGGCAGAGACAGAGGG - Intergenic
1000294472 5:159901251-159901273 CCTCAGAGGATAAAGGCAGAGGG + Intergenic
1000341358 5:160279582-160279604 CCTCACCTGCTGAGGGCAGTGGG + Intronic
1000552315 5:162682348-162682370 CTTCACATGGTGGAAGCAGGAGG + Intergenic
1000954204 5:167523084-167523106 CCTTACATGAGAAAGGCAGAGGG - Intronic
1001993268 5:176134440-176134462 CCTCACAAGGAGAAGCCAGGGGG + Intergenic
1002002553 5:176206265-176206287 TCTCACATGGTGAAAGCAGAAGG + Intergenic
1002224047 5:177705347-177705369 TCTCACATGGTGAAACCAGAAGG - Intergenic
1003193049 6:3890915-3890937 CCTCACATAGTGGAAGAAGAAGG - Intergenic
1003415594 6:5905109-5905131 CCTCAGGTGGTGTGGGCAGAGGG + Intergenic
1003441779 6:6149562-6149584 CCTCACATGGGGCAGAGAGAGGG - Intronic
1005689357 6:28287288-28287310 TGTGACAAGGTGAAGGCAGAGGG - Intronic
1005692882 6:28324028-28324050 GCTCACAGGGTGAAGGGAAAGGG - Intergenic
1006034408 6:31200312-31200334 CCTCACGTGGTGAAGAGAGTGGG - Intronic
1006340719 6:33445115-33445137 CCTCACTTGGTGGAGGCTGAGGG + Intronic
1006461500 6:34161887-34161909 CCACATATGGAGAAGGAAGAGGG + Intergenic
1006638129 6:35474721-35474743 CCACACATGCTGGAGGCTGAAGG + Exonic
1006761253 6:36463651-36463673 CCTCACATGATGGAAGGAGAAGG - Intronic
1006988506 6:38193327-38193349 ACTCACATGGTGGGGTCAGAGGG - Intronic
1009651179 6:66479726-66479748 CCTTAAATGGTGAAGGCTCAGGG + Intergenic
1009707117 6:67266285-67266307 CCCCACCTAGTGAAGACAGATGG + Intergenic
1011184292 6:84657272-84657294 CCTCACATAGAGAAGAGAGAGGG - Intergenic
1011843779 6:91535624-91535646 GACCACATGGTGTAGGCAGATGG - Intergenic
1012983009 6:105849825-105849847 CCTCACATGTTGAATGCAAAAGG - Intergenic
1013083067 6:106829723-106829745 CTTCACCTGTTGAAGTCAGAGGG + Intergenic
1013254556 6:108371491-108371513 ACTCACAAGGCTAAGGCAGAAGG - Intronic
1014573528 6:123041302-123041324 ACTAACATTTTGAAGGCAGAAGG - Intronic
1015175723 6:130306003-130306025 CCTCACATGGTGGAAGGAAAAGG + Intronic
1015235024 6:130961060-130961082 CCTGAGATGGTAAAGTCAGATGG + Intronic
1017173030 6:151475758-151475780 CCTCACGTGGAGAAGGCGGACGG + Intergenic
1017371179 6:153710972-153710994 TCTCACATGGTGGAAGCAGGAGG + Intergenic
1017595645 6:156025901-156025923 CCTCACATGGTGGAGGGGGAGGG - Intergenic
1019040686 6:169101747-169101769 CCTTACCTGCTGAAGGCAAATGG - Intergenic
1019723415 7:2587194-2587216 CCTGAGATGGGGGAGGCAGAGGG + Intronic
1019911006 7:4100575-4100597 CCTCACGTGGTGGAAGGAGAGGG - Intronic
1024271403 7:47645032-47645054 CCTCTCAGGGTGAAGGCATAAGG + Intergenic
1024390588 7:48807204-48807226 CCTCACATGGTGAAGGGGCAAGG - Intergenic
1026345008 7:69466152-69466174 ACTCATATGGTGAAGGCAGATGG - Intergenic
1028178873 7:87692346-87692368 ACTCACAAGGCGAAGGCAGGAGG + Intronic
1029374369 7:100168969-100168991 CCTCCCATCCTGAAGGCAGGGGG + Intergenic
1029639783 7:101813949-101813971 CCTCCCATGGGGAAGGCTCAAGG - Intergenic
1029972454 7:104802543-104802565 CCTCACATGGTGGAAGGGGAGGG - Intronic
1030063717 7:105643065-105643087 CCTAACCTAGTGAAGGCAGATGG - Exonic
1030799964 7:113837678-113837700 CTTCACATGGTGGAAGCAGGGGG - Intergenic
1032742045 7:134748938-134748960 CCTCACATGGTGAAAGGGGTGGG - Intronic
1033169729 7:139072942-139072964 CCTCTCATGGTGAGGAAAGAGGG + Intronic
1033490144 7:141835378-141835400 CCTCACATGGCAAAAGCAGGAGG + Intergenic
1034530566 7:151693750-151693772 CCTCACATGGTGGAAGGAGGAGG - Intronic
1034949835 7:155289838-155289860 CCTCACATGGTGAAGGGGCCAGG + Intergenic
1035578310 8:723173-723195 CCACTCTTGGGGAAGGCAGAGGG - Intronic
1036574470 8:10013444-10013466 CTTGACATGGTGGAGGCATAGGG + Intergenic
1037411354 8:18601640-18601662 CCTCACCTAGTGGAGGCAGAAGG - Intronic
1037945854 8:22988922-22988944 CCTTACATGGTGAGGTAAGAGGG - Intronic
1038687715 8:29733800-29733822 CATCAGAGGGTGAAGGGAGAGGG - Intergenic
1038926873 8:32150503-32150525 CCTCACATGGCAGAAGCAGAAGG - Intronic
1039833790 8:41238865-41238887 CCTCACATGGCAGAGGCAGGAGG + Intergenic
1040427618 8:47304597-47304619 CTTCACATGGTGAAAGCAGGGGG - Intronic
1041766066 8:61419524-61419546 GCTGACATGCTGAAGGCTGATGG + Intronic
1042120202 8:65479093-65479115 ATTGACAAGGTGAAGGCAGAGGG + Intergenic
1043231566 8:77808647-77808669 CCTCAAATGGTGCCTGCAGAAGG + Intergenic
1043953694 8:86338260-86338282 ACTCACGTGGTGATGGCAGCAGG + Intergenic
1044806192 8:96010711-96010733 CCTCAGATGGGGAAGGCAACTGG + Intergenic
1045658464 8:104411289-104411311 CCTCACATGGTGGAGGCGAGGGG - Intronic
1046551776 8:115727374-115727396 CCCCAAATGATGAAGGCAGAAGG + Intronic
1046670836 8:117054418-117054440 CCTCACAGGGTTAAATCAGATGG - Intronic
1047539258 8:125748393-125748415 CCTCACATGGTAAAGGGGCAAGG + Intergenic
1047589498 8:126312201-126312223 CATCTCATGGTGAAGTCAAATGG + Intergenic
1047736981 8:127774583-127774605 GCTCACATGGTTATGGCAGCTGG - Intergenic
1048922672 8:139245456-139245478 TGTCACATGGTGAAGGCAGGAGG + Intergenic
1049459030 8:142713506-142713528 CCTCACATGGTGGAGAGAGAAGG - Intergenic
1050005803 9:1128989-1129011 CCTCACATGGAGGAAGGAGAAGG - Intergenic
1050014828 9:1222454-1222476 CCTCACTTGGTGAAGGTGGAAGG - Intergenic
1050160801 9:2717422-2717444 CCTCACAGGGTCAAGGGAGTGGG + Intergenic
1050208723 9:3228656-3228678 CCTCATATGTAGAAGGCATAGGG + Intronic
1051345266 9:16145580-16145602 CCTCACATGCTGAAGGCCTGGGG + Intergenic
1052257074 9:26469847-26469869 TCTCTCAAGGTGAGGGCAGAAGG - Intergenic
1055336469 9:75237470-75237492 CCTTAAATGGTGAAGGCTCAGGG + Intergenic
1055829248 9:80359884-80359906 GCTCAAGTGGTGAAGGCAGTGGG + Intergenic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1056497742 9:87176821-87176843 GCTCATATGGTGAAGACAGAAGG + Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1058109575 9:101017708-101017730 CCTCACATGGTGAAGGCAGAAGG + Intergenic
1059347241 9:113637323-113637345 CCTCACACGGCCAGGGCAGAAGG - Intergenic
1060092742 9:120758521-120758543 ACACAAGTGGTGAAGGCAGAAGG + Exonic
1061912673 9:133733343-133733365 GCTGAAATGGTGAAGGCAGAAGG + Intronic
1062117662 9:134818035-134818057 CCTCAGGTGGGCAAGGCAGACGG - Intronic
1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG + Intronic
1188678215 X:32969072-32969094 CCTCACATGGTGGAGGGGAAAGG - Intronic
1192502851 X:71664839-71664861 CCTCCCAGGCTGTAGGCAGAGGG + Intergenic
1193090232 X:77486200-77486222 TGTCACATGGTGAAAGCAGGAGG + Intergenic
1195315138 X:103670036-103670058 CATCCCATGGTGGAAGCAGAAGG - Intergenic
1196022764 X:111007511-111007533 CCTCACCTGGAGGAGGCAGCTGG - Intronic
1196095543 X:111794722-111794744 CCTCATATGGTGAAGCAAAAGGG + Intronic
1196281552 X:113828774-113828796 CCTTAGAGGGTGCAGGCAGATGG - Intergenic
1197341478 X:125272128-125272150 CCTCAAAAGTTGAAAGCAGAGGG - Intergenic
1197642114 X:128978204-128978226 TGTCACATGGTGAAAGCAGGTGG + Intergenic
1197929769 X:131682232-131682254 CCTCACATGGTGGAAGCAACAGG - Intergenic
1198127682 X:133662404-133662426 CCTCTCATGGAGAACGCAGAGGG - Intronic
1199228940 X:145412223-145412245 CCTTATAAGGTGAAGGCAGGAGG - Intergenic
1200983459 Y:9283189-9283211 TCCCACCTGGTGAAGGTAGAAGG - Intergenic
1201597585 Y:15689043-15689065 CCTCATTTGGGGAGGGCAGAGGG - Intergenic
1202126920 Y:21576498-21576520 TCCCACCTGGTGAAGGTAGAAGG + Intergenic