ID: 949312361

View in Genome Browser
Species Human (GRCh38)
Location 3:2714135-2714157
Sequence CCTGTTGGCCAGGCAGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 278}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949312361 Original CRISPR CCTGTTGGCCAGGCAGTGTT GGG Intronic
901510715 1:9716897-9716919 CCTGGTGTCCAGGGAGTGGTTGG + Intronic
901887524 1:12233205-12233227 CATGTTGGCCAGGCTGGGTTTGG + Intronic
903264723 1:22150910-22150932 CCTGCTGGCCAGGCTGTGCAGGG - Intergenic
903510968 1:23874667-23874689 CCAGTGAGCCAGGCAGTGATGGG + Exonic
903790557 1:25890086-25890108 CCTACTTACCAGGCAGTGTTAGG - Intronic
903849725 1:26298588-26298610 CATGTTGGCCAGGCTGGTTTTGG - Intronic
905172628 1:36118260-36118282 CCTGGGGGCCAGGCAGAGCTGGG - Intronic
907041047 1:51260018-51260040 CCTGTTTGCAAGGTGGTGTTAGG + Intronic
907404664 1:54246607-54246629 CCTGAAGGCCAGGCAGGGTCAGG - Intronic
908222057 1:62017210-62017232 CATGTTGCCCAGGCTGGGTTAGG - Intronic
908588153 1:65597213-65597235 CCTGTTGTCCATGCTGTGTTTGG + Intronic
908676602 1:66611519-66611541 ACTGTTGGCCAGCAAGAGTTTGG - Intronic
911150667 1:94594523-94594545 CCTGCTGGCCAGGCTGGGTTAGG - Intergenic
911354690 1:96801657-96801679 CATGTTGGCCAGGCTGGTTTTGG - Intronic
912828922 1:112932598-112932620 CATGTTGGCCAGGCTGGTTTTGG - Intronic
913966068 1:143378547-143378569 CATGTTGGCCAGGCTGGTTTCGG + Intergenic
914060442 1:144204154-144204176 CATGTTGGCCAGGCTGGTTTCGG + Intergenic
914118708 1:144762215-144762237 CATGTTGGCCAGGCTGGTTTCGG - Intergenic
914858365 1:151368245-151368267 CCCGCTGGCCAGGCAGTGGCTGG + Exonic
914992083 1:152507505-152507527 TGTGTTGGACAGGCAGTGTCTGG - Intergenic
915329752 1:155103359-155103381 CATGTTGGCCAGGCTGTTCTCGG + Intergenic
917185258 1:172346835-172346857 CCTGTTTGCCAGGCATTATTTGG - Intronic
920328897 1:205190421-205190443 CATGTTGGCCAGGCTGGTTTCGG - Intronic
920451185 1:206062381-206062403 CTTGTTGGCCAGGCTGTCTCAGG - Intronic
921462486 1:215445207-215445229 CCTGGTGGCAGGGCAGTCTTGGG - Intergenic
922603561 1:226874803-226874825 CCTCTTGGCCAGGGAGTATGTGG + Intronic
923238524 1:232058327-232058349 CATGTTGCCCAGCTAGTGTTGGG + Intergenic
923403794 1:233640990-233641012 CCTGTTGGCCAGGGACAGTGTGG - Intronic
924593833 1:245428083-245428105 ACTGGTGGCCAAGCAGTGTCAGG + Intronic
1062918713 10:1263344-1263366 CCTGCATGCCAGGCAATGTTTGG - Intronic
1063113017 10:3053050-3053072 CCTTTTTTCCAGGCTGTGTTGGG + Intergenic
1064392964 10:14957439-14957461 ACTGTGTGCTAGGCAGTGTTAGG + Intergenic
1065726940 10:28676728-28676750 CGTGTTTGCCAGCCATTGTTTGG + Intergenic
1069410049 10:68143954-68143976 CATGTTGGCCAGGCTGTTCTTGG + Intronic
1069442046 10:68437911-68437933 CATGTTGGCCAGGCTGGATTCGG + Intronic
1069644003 10:69978728-69978750 CCTGTTGGCCAGGCTGGTCTTGG - Intergenic
1070624554 10:78041372-78041394 CCTGCTGGCCAGGGGGTGGTTGG + Intronic
1072650799 10:97293595-97293617 CCTGTTGGCCAGGCTGGAGTCGG + Intergenic
1072663247 10:97375900-97375922 CATGTTGGCCAGGCAGGTCTCGG - Intronic
1073212229 10:101814125-101814147 CATGTTGGCCAGGCTGGGTCTGG - Intronic
1074569458 10:114611263-114611285 CATGTTGGCCAGGCTGTTCTCGG - Intronic
1075596666 10:123735973-123735995 CTTGTTGGCCAGGCTGGGCTTGG + Intronic
1075967168 10:126623064-126623086 GCTGCTGGCCAGGCAGGGTCGGG - Intronic
1076001711 10:126917957-126917979 CTTGTTAGCCAGGCATAGTTAGG + Intronic
1076818404 10:132925894-132925916 CCTGTCAGCCAGGCAGTGCGAGG - Intronic
1077068531 11:656355-656377 CCTGTTGGCCAGGCTGGTCTCGG + Intronic
1084029407 11:66472487-66472509 CCTGGTGGCCAGGAGGTGTGTGG - Intronic
1084205292 11:67587891-67587913 CATGTTGGCCAGGCTGGTTTCGG + Intergenic
1084428502 11:69098494-69098516 CATGTTGGCCAGGCTGGGTCAGG + Intergenic
1085451710 11:76637904-76637926 TCTGTTTGCCAGGCTGTGTCAGG + Intergenic
1085508794 11:77074873-77074895 CCTGGTGGCCAGCCACTGGTGGG - Intronic
1087400164 11:97655083-97655105 CATGTTGGCCAGGCTGATTTTGG - Intergenic
1088305991 11:108408472-108408494 CATGTTGGCCAGGCTGGCTTTGG - Intronic
1088700122 11:112404109-112404131 ACTGTATGCCAGGCAGTGCTAGG + Intergenic
1089157428 11:116413368-116413390 CCTGTGGGCCTGGGAGGGTTTGG - Intergenic
1089662651 11:119995634-119995656 ACTATAAGCCAGGCAGTGTTAGG - Intergenic
1089678390 11:120105809-120105831 CCTGGTGGCCATGCAGTCATGGG - Intergenic
1089873355 11:121696210-121696232 CCTGTGGGCCGGGAAGTTTTTGG - Intergenic
1091629697 12:2150372-2150394 CCTGTTCCCCAGGGAATGTTGGG - Intronic
1091765416 12:3117150-3117172 CCTGTTTTCCAGGCTGTCTTGGG + Intronic
1093961998 12:25284316-25284338 CATGTTGGCCAGGCTGTTCTTGG - Intergenic
1095542770 12:43330091-43330113 CCTGCTGGCAGGGCAGTCTTGGG - Intergenic
1095708730 12:45265905-45265927 ACTATTTGCCAGGCACTGTTAGG + Intronic
1095713532 12:45316188-45316210 CCTGTTGAGCAGGTACTGTTGGG + Intronic
1097474928 12:60042112-60042134 CATGTTGGCCAGGCTGTTCTGGG - Intergenic
1100275147 12:93064987-93065009 CCTGATGTTCAGGCACTGTTGGG + Intergenic
1100553381 12:95668786-95668808 CATGTTGGCCAGGCTGGTTTTGG - Intronic
1101403826 12:104411248-104411270 CATGTTGGCCAGGCTGGTTTTGG - Intergenic
1102010432 12:109615157-109615179 CATGTTGGCCAGGCTGGTTTGGG + Intergenic
1102243677 12:111341713-111341735 CCTGCTGGCCAGGAACTTTTGGG + Intronic
1102382446 12:112478932-112478954 CATGTTGGCCAGGCTGGTTTTGG + Intronic
1102470438 12:113156940-113156962 CCCGGAGGCCAGGGAGTGTTAGG - Intronic
1103535375 12:121630115-121630137 CCAGGTGGCCGGGAAGTGTTGGG + Intronic
1103572986 12:121857279-121857301 CATGTTGGCCAGGCAGGGGTTGG + Intronic
1105821277 13:24083317-24083339 CCTGTGGGCGGGGCAGGGTTTGG - Intronic
1106723076 13:32455701-32455723 ACTGGTGGGGAGGCAGTGTTAGG - Intronic
1107690470 13:42948142-42948164 CATCTAGGCCAGGCAGGGTTAGG + Intronic
1108019583 13:46113383-46113405 CTTGATGGCAAGGCACTGTTGGG - Intergenic
1108343153 13:49517367-49517389 CATGATGGCTAGGCAGTGTGTGG - Intronic
1109741366 13:66560131-66560153 TCTGTTGGTAAGGAAGTGTTCGG - Intronic
1110569504 13:76989557-76989579 CATGTGGTCCAGGCAGTCTTAGG + Intergenic
1111122962 13:83878971-83878993 CCTGTTGGCTACGCAGGGATGGG - Exonic
1111530603 13:89532645-89532667 CATGTTGGCCAGGCTGATTTTGG + Intergenic
1113421172 13:110172604-110172626 CCTGTTGGCCAGGCAGCAACGGG - Intronic
1113726354 13:112605541-112605563 CCATTTGACCAGGCAGTGCTGGG + Intergenic
1114193574 14:20458618-20458640 CCTGTTGGCTGTGCTGTGTTTGG - Exonic
1115760508 14:36576295-36576317 CCAGTTGTCCACTCAGTGTTGGG - Intergenic
1117324597 14:54657593-54657615 CCTGTTGTCAAGACTGTGTTGGG + Intronic
1118351635 14:64976309-64976331 CATGTTGGCCAGGCTGTTCTTGG - Intronic
1118514861 14:66516217-66516239 CATGTTGGCCAGGCTGGTTTTGG + Intronic
1119541840 14:75444103-75444125 CATGTTGCCCAGGCTGTTTTTGG + Intronic
1120388919 14:83881089-83881111 CCTGTAGGCCAGGCTGTGAAAGG - Intergenic
1123976399 15:25558347-25558369 CCTGATGGAAAGGCAGTGGTGGG + Intergenic
1124224699 15:27883098-27883120 CCTGCAGGCCAGGGAGTGTGGGG - Intronic
1124235108 15:27983604-27983626 CCTGTGGGGAAGGCAGTGCTGGG + Intronic
1125216123 15:37277418-37277440 CCTGTAGGATAGGCAGTGTCAGG + Intergenic
1125598666 15:40903477-40903499 GCTGTTGGCCAGGAGGTGTCAGG + Exonic
1125960253 15:43823955-43823977 CCTGTTGGCAGGGCATTGTGCGG - Intronic
1126697815 15:51341021-51341043 CCTGTTGGCCAGGCAGTCCTGGG + Intergenic
1127427273 15:58868668-58868690 CATGTTGGCCAGGCTGGTTTGGG + Intronic
1131119250 15:89812960-89812982 CTTGTTAGCCAGGGAGTGCTGGG + Intronic
1132001024 15:98180262-98180284 CCTGTTTGGCAGGCATTTTTTGG - Intergenic
1133334516 16:4998205-4998227 CATGTTGGCCAGGCTGTTCTTGG + Intronic
1133466349 16:6030885-6030907 GCTCTGGGCCAGGCACTGTTAGG + Intronic
1134210910 16:12276092-12276114 CATGTTGGCCAGGCTGGTTTCGG + Intronic
1135051547 16:19196974-19196996 TCTGTTTACCAGGCAGTTTTTGG - Intronic
1135426398 16:22340487-22340509 CATCTTGGCCTCGCAGTGTTGGG - Intergenic
1136021737 16:27444868-27444890 CCTGCTGGCCAGGCCCTGTTGGG + Intronic
1136455345 16:30377009-30377031 CGTGTTGGCCAGGCTGTTCTTGG - Intronic
1138509146 16:57497862-57497884 CCTCTTGGGCAGGCCGTGTGAGG - Intergenic
1138753700 16:59456279-59456301 ACTACTCGCCAGGCAGTGTTTGG - Intergenic
1139388497 16:66589605-66589627 CCTGCAGGCCAGGCAGTGTGAGG + Intergenic
1139421404 16:66851523-66851545 CCTGATGGCCTGGCTGTGGTTGG + Exonic
1140053412 16:71503194-71503216 CCTGTAGGCATGGCTGTGTTTGG - Intronic
1141407818 16:83808790-83808812 CCTATTTGCCGGGCAGTGGTGGG + Intronic
1141590253 16:85063674-85063696 AGTGTTTGCCATGCAGTGTTAGG + Intronic
1141885623 16:86890251-86890273 CCTGTTGGCTGGGCACTGGTAGG - Intergenic
1141899631 16:86982717-86982739 CATGTTGGCCAGGCTGGTTTTGG + Intergenic
1142354171 16:89594313-89594335 CCTGTTTGCAAGGCAGTCTCTGG - Intronic
1143090066 17:4444858-4444880 CATGTTGGCCACGCACTGTGAGG + Intronic
1143899496 17:10163324-10163346 CATGTTGGCCAGGCTGGTTTTGG + Intronic
1144366240 17:14547558-14547580 ACTGTGGACCAGGCAGAGTTGGG + Intergenic
1144522792 17:15965330-15965352 TTTGCTTGCCAGGCAGTGTTAGG + Intronic
1145064674 17:19754003-19754025 CCAGCTGGCCTGGCAGTGTGTGG + Intergenic
1145936214 17:28716494-28716516 GCTGTGTGCCAGGCAGTGTTGGG - Intronic
1147150656 17:38511721-38511743 CCTGTTCCCCAGACAGTTTTTGG + Exonic
1147165304 17:38589952-38589974 CCTCTGGGTCAGGCAGTCTTTGG + Intronic
1148746902 17:49923611-49923633 CCTGTAGGAGAGGCAGTGTGGGG + Intergenic
1148992730 17:51680568-51680590 CCTGTTCCCCAGGGAGTGTTTGG + Intronic
1149898423 17:60449996-60450018 CATGTTGGCCAGGCTGGGCTTGG + Intronic
1151613020 17:75189072-75189094 CCTGTTGGCCAGGCTGATCTTGG - Intergenic
1152521709 17:80860293-80860315 CCTGTTGTCCAGGCACTGGCAGG + Intronic
1156961419 18:43036336-43036358 CATGTTGGCCAGGCTGTTCTAGG - Intronic
1157290930 18:46409096-46409118 CCTGTATGCCAGGCACTGTTAGG - Intronic
1157386208 18:47261431-47261453 CCTGTTGGTCAGGCAGGGCAGGG + Intergenic
1158204650 18:54979384-54979406 CCTGTTGGCCATCCAATGTAAGG - Intergenic
1158400227 18:57115181-57115203 CCTGTAGATCAGGCAATGTTTGG - Intergenic
1159075940 18:63682306-63682328 CCTGTTTTCCAGGCAATCTTGGG - Intronic
1159400426 18:67925496-67925518 CATCTTGGCCAAGCAGTGTATGG + Intergenic
1160519051 18:79494076-79494098 CCTGTGCGCCAGGCAGCGTGTGG + Intronic
1161745460 19:6056906-6056928 CCCGTTGGCCAGGCAGGGCCAGG - Intronic
1162556794 19:11391978-11392000 CATGTTGGCCAGGCTGGTTTTGG + Intronic
1164432745 19:28202055-28202077 CATGTTGGCCAGGCTGTTCTTGG + Intergenic
1165920122 19:39291942-39291964 CCTGTTGGCCAGGCTGGTCTTGG + Intergenic
1167584944 19:50368973-50368995 CCCATTGGCCGGGCCGTGTTCGG - Intronic
1168021521 19:53612337-53612359 TCTGTTGTCCAGGCAGTGGTAGG - Intergenic
1202699845 1_KI270712v1_random:156038-156060 CATGTTGGCCAGGCTGGTTTCGG + Intergenic
925261095 2:2529296-2529318 CGTAGTGGCCAGGCTGTGTTAGG - Intergenic
925359697 2:3268694-3268716 CCTGTTGACCAGGAAGCTTTGGG + Intronic
926059747 2:9797784-9797806 CATGCTGGCCAGACAGTGCTGGG - Intergenic
927645318 2:24873597-24873619 CCTGGCCGCCAGGCAGGGTTGGG - Intronic
927742185 2:25581271-25581293 CTTGTGTGCCAGGCACTGTTAGG - Intronic
929619927 2:43344121-43344143 CCTCTTGGCCAGCCAGAGTTTGG + Exonic
929881151 2:45838264-45838286 TCAGTTGGCCAGGCAGGGCTGGG + Intronic
930007584 2:46910371-46910393 CCTGTTGGGAAGTGAGTGTTCGG - Intronic
930029959 2:47052328-47052350 TCTGAAGGCCAGCCAGTGTTGGG + Intronic
932030380 2:68177665-68177687 CATGTTGGCCTCCCAGTGTTGGG - Intronic
933053777 2:77634912-77634934 CATGTTGGCCAGGCTGTTCTTGG + Intergenic
934568624 2:95354296-95354318 GATGCTTGCCAGGCAGTGTTGGG - Intronic
935735692 2:106105221-106105243 GCTGTTGGGCAGTCAGTGTGAGG - Intronic
936039718 2:109141007-109141029 CCTGTTGGGCAGGCGGTATCTGG + Intronic
938079753 2:128363484-128363506 CATGTTGGCCAGGCTGGTTTTGG + Intergenic
938119219 2:128622146-128622168 CCTCTTGTCCACGCTGTGTTTGG + Intergenic
938295337 2:130174798-130174820 CCTCTGTGCCAGGCAGTGCTCGG + Intronic
938461283 2:131499047-131499069 CCTCTGTGCCAGGCAGTGCTCGG - Intergenic
946297092 2:218793913-218793935 CATGTTGGCCAGGCTGTTGTAGG + Intronic
946560300 2:220904952-220904974 CATGTTGGCCAGGCTGGTTTCGG - Intergenic
948666062 2:239535639-239535661 CCTGGTGGCCAGTCAGGGTAGGG - Intergenic
1169171638 20:3470468-3470490 CCTGTTGGCCAGGCTGGTCTCGG + Intergenic
1169339212 20:4783317-4783339 CCTGGTGGCCAGGAAGTTTCAGG - Exonic
1170068947 20:12344306-12344328 CCTCTTGGCCAGGCCGAGCTAGG - Intergenic
1170106149 20:12755552-12755574 CCTCTTGGCCAGGCCGAGCTAGG + Intergenic
1171980268 20:31623121-31623143 CCTGTTAGCCAGACAGTGTGAGG + Intergenic
1172686260 20:36757375-36757397 CATGTTGGCCAGGCTGGGCTGGG - Intronic
1172919324 20:38468160-38468182 CCTGTTGGCCAGGCTGGTCTCGG + Intergenic
1174366677 20:50060797-50060819 GCTGTTGTTCAGGCTGTGTTGGG + Intergenic
1174733299 20:52939358-52939380 CTTATTGGCTAGGCAGTATTTGG + Intergenic
1176660549 21:9630985-9631007 TCTGTTGCCCAGGCAGGGATGGG - Intergenic
1178851096 21:36212981-36213003 CCTGTTGGCCAGGCTGATCTTGG + Intronic
1178898921 21:36583681-36583703 TCTGTTGGCCAGGCCAGGTTGGG + Intergenic
1179887835 21:44322038-44322060 CCCGGGGGCCAGCCAGTGTTGGG - Intronic
1180713273 22:17854509-17854531 CCTGTTCACCAGGCAGTTCTCGG - Intronic
1180727086 22:17954308-17954330 CCACTTGTCCATGCAGTGTTAGG - Intronic
1181028233 22:20137798-20137820 CCTGTGTGCCAGGCAGGGCTGGG + Intronic
1181806087 22:25375239-25375261 CCTGGGGGCCACGCAGGGTTGGG - Intronic
1182300072 22:29332184-29332206 CCTCTGGGCCAGGCACTGGTGGG + Intronic
1183141952 22:35950719-35950741 TCTCTCGGCCAGGAAGTGTTTGG + Intronic
1183696385 22:39425906-39425928 CCTGTTGGCCAGGCTGGTCTCGG + Intronic
1184293707 22:43511074-43511096 CCAGCTGGCCAGGCAGGTTTAGG - Intergenic
1185427126 22:50778377-50778399 CCTGTTGGCCAGGCTGCTCTCGG - Intronic
949312361 3:2714135-2714157 CCTGTTGGCCAGGCAGTGTTGGG + Intronic
949892500 3:8743757-8743779 CATGTTGCTCAGACAGTGTTGGG - Intronic
950266195 3:11574962-11574984 CCTTTTGGCTTGGTAGTGTTTGG + Intronic
953502815 3:43454458-43454480 TCTGATGGCCAGACAGTCTTGGG - Intronic
953584055 3:44184081-44184103 TCTGATGGGCAGGAAGTGTTGGG + Intergenic
954854783 3:53634896-53634918 CCTGGAGGGCAGGCAGTCTTGGG + Intronic
954936374 3:54330724-54330746 CCTCTTGGCCAGCCAGTGGGTGG + Intronic
955596118 3:60592581-60592603 CCTGCTGCCCAGGCAGTGAATGG - Intronic
956388804 3:68749666-68749688 ACTGTTTGCCAGACAATGTTAGG + Intronic
958885769 3:99725228-99725250 CCTGCTGTCCAGGGAGAGTTCGG - Intronic
959557925 3:107744168-107744190 CATTGTGCCCAGGCAGTGTTGGG + Intronic
959784977 3:110285244-110285266 CGTGTTGGCCAGGCAGGTCTCGG + Intergenic
960943173 3:122947678-122947700 CCTGTTGGGGAGGCAGTGCCAGG - Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
962321552 3:134394864-134394886 CATGTTGGCCAGGCTGGTTTTGG + Intergenic
967217243 3:187220927-187220949 CCTGGTGGGCTGGCAGTGTGGGG - Intronic
967537626 3:190625103-190625125 CCTCTTCGCCATCCAGTGTTTGG + Intronic
967951950 3:194848022-194848044 CCTGCAGGCCAGGCTGTGTGTGG - Intergenic
968890456 4:3366061-3366083 GCTGCAGGCCAGGCAGTGGTGGG + Intronic
968916428 4:3498836-3498858 CCTCAGGGCCAGGCAGGGTTGGG + Intronic
970101177 4:12524339-12524361 CCTGTTTGCAGGGCAGTCTTGGG + Intergenic
971058256 4:22937760-22937782 TCTGTATGCCAGGCATTGTTTGG - Intergenic
973336346 4:48960296-48960318 CATGTTGGTCAGGCAGTGGTGGG + Intergenic
976804418 4:89029943-89029965 CCTGTTAACCAGGTAGTGCTGGG - Intronic
977939799 4:102845990-102846012 CCTGTTGGCCAGGCTGGTCTCGG + Intronic
978360751 4:107929236-107929258 CCTGTTGGCCAGGCTGGTCTAGG - Intergenic
984839896 4:184058609-184058631 CCCCTTGGCAAGGCAGTGTGTGG - Intergenic
985414813 4:189725429-189725451 TCTGTTGCCCAGGCAGGGATGGG + Intergenic
985959177 5:3286805-3286827 CCTGTTTACCAGGGAGTGCTGGG - Intergenic
986605895 5:9522379-9522401 CATGTTGGCCAGGCTGTTCTCGG - Intronic
988676027 5:33434022-33434044 CATGTAGGCCAGGCAGGGTGAGG + Intergenic
989046300 5:37277158-37277180 CATGTTGGCCGGGCTGTGCTTGG + Intergenic
991283603 5:64943872-64943894 ACTCTTTGCCAGCCAGTGTTTGG - Intronic
997339034 5:133128158-133128180 TCTCTGGGCCAGGCAGTGATGGG + Intergenic
999147895 5:149407807-149407829 CCTGAGGGACAGCCAGTGTTGGG + Intergenic
999229884 5:150055474-150055496 CCTGTGTGCCAGCCAGTGTGTGG + Intronic
999310619 5:150549419-150549441 CCTGAGGGGCAGGCAGGGTTTGG + Intronic
999683284 5:154079979-154080001 CATGTTGGCCAGGCTGGTTTTGG - Intronic
1001921889 5:175607008-175607030 ACTGTGGGCCAGGCAGAATTTGG + Intergenic
1001980552 5:176034902-176034924 CCTGCTCCCCAGGGAGTGTTGGG - Intergenic
1002488064 5:179553167-179553189 ACTCTTGCCCAGGCAGCGTTGGG + Intronic
1003234654 6:4284763-4284785 CCTGTGTGCCAGGCACTGTCAGG + Intergenic
1004427422 6:15515830-15515852 CATGTTGGCCAGGCTGTGATTGG - Intronic
1009272291 6:61628601-61628623 CCTTTTTGACAGGCACTGTTTGG - Intergenic
1009417727 6:63434235-63434257 CATGTTGGCCAGGCTGGGCTCGG - Intergenic
1010250985 6:73706819-73706841 CCTTTTGGCAGGGCTGTGTTAGG + Intronic
1011065717 6:83323343-83323365 CCTGTTTGCCAGTCTGTGTCTGG - Intronic
1013410298 6:109877576-109877598 CCTCTTGGCAAGGCTTTGTTTGG + Intergenic
1014434994 6:121410841-121410863 CCTGTTGGCCAGGCTGATCTCGG - Intergenic
1014788825 6:125647756-125647778 CCTGTTGGCAAGGAGGAGTTGGG + Intergenic
1015009063 6:128321815-128321837 CCTGTTGATGAGGAAGTGTTTGG - Intronic
1019682200 7:2356754-2356776 TCTGTCGCCCAGGCAGTGGTGGG - Intronic
1019724158 7:2591820-2591842 CATGTTGGCCAGGCTGAGTCTGG + Intronic
1021704854 7:23356525-23356547 TCTGTTGCCCAGGCAGACTTGGG - Intronic
1022673677 7:32478811-32478833 ACTGCTGGCCATGCTGTGTTTGG - Intergenic
1023743417 7:43301185-43301207 GCTGTCTGCCAGACAGTGTTGGG - Intronic
1023882054 7:44326181-44326203 CCTCCTGGCCAGGCAGCCTTTGG - Intronic
1023989500 7:45119611-45119633 CCTCCAGGCCAGGGAGTGTTTGG - Intergenic
1024679030 7:51664411-51664433 CATGTTGACCAGGTAGTTTTTGG - Intergenic
1026193313 7:68149580-68149602 CATGTTGGCCAGGCTGGTTTTGG + Intergenic
1028925852 7:96356220-96356242 ACTGTGTGCCAGGCAGTTTTAGG - Intergenic
1029882956 7:103836166-103836188 CATGTTGGCCAGGCTGGTTTTGG + Intronic
1030454392 7:109754784-109754806 CATGTTGGCCAGGCTGTCATAGG + Intergenic
1032488733 7:132307912-132307934 CCGATTGTCCTGGCAGTGTTTGG - Intronic
1032572647 7:133016792-133016814 CCTGTTGGTAATGCTGTGTTAGG - Intronic
1032609156 7:133392403-133392425 TCTGTTTGGGAGGCAGTGTTAGG + Intronic
1032816607 7:135482352-135482374 CATGTTGCCCAGGCTGTTTTTGG - Intronic
1032816808 7:135483990-135484012 CATGTTGGCCAGGCTGGTTTCGG - Intronic
1036183704 8:6606532-6606554 CCTGTCGACCAGGGAGTGTCAGG + Intronic
1036636560 8:10554638-10554660 CCTGGTGGCCAGCCAGGTTTGGG + Intergenic
1036731741 8:11271636-11271658 CCACTTGGCCAGGCTGTGTCTGG - Intergenic
1039261380 8:35775441-35775463 ACTGATGGCCAGGCAGGTTTGGG + Intronic
1040657944 8:49534287-49534309 ACTGTTGGCCAGTCTGTGTAAGG - Intergenic
1042203173 8:66301921-66301943 CCTGTTAGACAGGCATTGCTTGG + Intergenic
1042892380 8:73626954-73626976 CCTGGTGGTCAGACAGTGTGTGG + Intronic
1042894738 8:73653734-73653756 CCTGATGTTCAGTCAGTGTTAGG + Intronic
1044531270 8:93310249-93310271 CCTTTGTGCCAGGGAGTGTTAGG - Intergenic
1049042567 8:140123774-140123796 TTTGATGGCCAGGCACTGTTTGG - Intronic
1049434531 8:142580220-142580242 CCTTATGGCCTGGCAGTGGTGGG - Intergenic
1050938744 9:11431561-11431583 CCAGTTGGAGAGGCAGTGATTGG - Intergenic
1051072692 9:13191659-13191681 ACTGTGTGCCAGGCAGAGTTGGG + Intronic
1051439866 9:17072777-17072799 CCTGTGGGCCGGGCACTGCTGGG - Intergenic
1052534157 9:29726554-29726576 CCTGCTTGCCAGGCACTCTTTGG + Intergenic
1055459395 9:76503602-76503624 CCTCTTTGCCATCCAGTGTTTGG + Exonic
1056032665 9:82569234-82569256 CCCATTGGCCAGGCACTGTGTGG - Intergenic
1056121408 9:83492601-83492623 CCCGGTGGCCAGACAGGGTTAGG - Intronic
1057145645 9:92757440-92757462 TCTGTTGTCCAGTCAGTGTTTGG - Intronic
1057167604 9:92941068-92941090 CCAGTTGTCCATGCTGTGTTTGG - Intergenic
1058584703 9:106494571-106494593 TCTGTTGCCCAGGCAGTGGCGGG + Intergenic
1060088203 9:120720579-120720601 AGTGTTGGGCAGGCAGTGCTAGG - Intergenic
1060302526 9:122383599-122383621 GCTGTGGGCCAGGAGGTGTTTGG + Exonic
1061494399 9:130963484-130963506 CCACTTGTCCAGGCTGTGTTTGG - Intergenic
1062013945 9:134281921-134281943 TCTGGTGGCCAGGCAGTGAGTGG + Intergenic
1062146973 9:134994906-134994928 CCTGCTGGGCATGCTGTGTTAGG + Intergenic
1062733866 9:138123976-138123998 CCATTTCCCCAGGCAGTGTTGGG + Exonic
1203638119 Un_KI270750v1:132829-132851 TCTGTTGCCCAGGCAGGGATGGG - Intergenic
1186473281 X:9837665-9837687 CCAGGTGGCCAGACTGTGTTGGG + Intronic
1187669176 X:21651514-21651536 CCTCTGGGCCAGCCAGAGTTGGG - Intronic
1187933734 X:24316126-24316148 CCTGTGGCCCAGGCAGCCTTGGG - Intergenic
1190253085 X:48742330-48742352 CGTGTTGGCCAGGCTGGTTTGGG - Intergenic
1190407197 X:50099922-50099944 TCTGTTAGCCAGGCAGTACTAGG + Intergenic
1193141153 X:78028388-78028410 CATGTTGGCCAGGCAGGTCTCGG + Intronic
1196759623 X:119189828-119189850 GCTGCAGGCCTGGCAGTGTTGGG + Intergenic
1197658395 X:129143032-129143054 CCTGTGGACCAGGCTGTATTGGG + Intergenic
1200090510 X:153633788-153633810 CCTGTTGGCCCCACAGTGCTGGG - Intergenic
1201586150 Y:15563449-15563471 CATGTTGGCCAGGCTGGTTTTGG - Intergenic