ID: 949312817

View in Genome Browser
Species Human (GRCh38)
Location 3:2719457-2719479
Sequence GCTGATTTTTTAGCAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11181
Summary {0: 1, 1: 5, 2: 71, 3: 468, 4: 10636}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949312809_949312817 20 Left 949312809 3:2719414-2719436 CCTCCCAAGTAGCTGGGACTGCA 0: 1471
1: 46349
2: 160458
3: 223343
4: 230646
Right 949312817 3:2719457-2719479 GCTGATTTTTTAGCAGAGACAGG 0: 1
1: 5
2: 71
3: 468
4: 10636
949312811_949312817 17 Left 949312811 3:2719417-2719439 CCCAAGTAGCTGGGACTGCAGGA 0: 45
1: 2607
2: 55121
3: 218673
4: 282661
Right 949312817 3:2719457-2719479 GCTGATTTTTTAGCAGAGACAGG 0: 1
1: 5
2: 71
3: 468
4: 10636
949312812_949312817 16 Left 949312812 3:2719418-2719440 CCAAGTAGCTGGGACTGCAGGAA 0: 16
1: 1754
2: 41805
3: 171761
4: 173282
Right 949312817 3:2719457-2719479 GCTGATTTTTTAGCAGAGACAGG 0: 1
1: 5
2: 71
3: 468
4: 10636
949312807_949312817 26 Left 949312807 3:2719408-2719430 CCTCAGCCTCCCAAGTAGCTGGG 0: 89011
1: 200457
2: 243521
3: 257984
4: 301655
Right 949312817 3:2719457-2719479 GCTGATTTTTTAGCAGAGACAGG 0: 1
1: 5
2: 71
3: 468
4: 10636

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949312817 Original CRISPR GCTGATTTTTTAGCAGAGAC AGG Intronic
Too many off-targets to display for this crispr