ID: 949315516

View in Genome Browser
Species Human (GRCh38)
Location 3:2750559-2750581
Sequence AAGTCCCCCTTGATGAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949315515_949315516 9 Left 949315515 3:2750527-2750549 CCTTCTTTGATTAAATAAGGATA 0: 1
1: 0
2: 1
3: 30
4: 349
Right 949315516 3:2750559-2750581 AAGTCCCCCTTGATGAGATATGG 0: 1
1: 0
2: 1
3: 8
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949315516 Original CRISPR AAGTCCCCCTTGATGAGATA TGG Intronic
909697680 1:78485265-78485287 AAGACCACCTTGCTGAAATAAGG + Intronic
916848876 1:168682994-168683016 AAGACCATCTTGCTGAGATAAGG - Intergenic
917079206 1:171238767-171238789 AAGACCACCTTGCTGAAATAAGG + Intergenic
917356288 1:174130202-174130224 AAGACCACCTTGCTGAAATAAGG - Intergenic
917582183 1:176390450-176390472 AAGACCACCTTGCTGAAATAAGG - Intergenic
918301899 1:183212245-183212267 AAGTCCCTCATGATGAAATTTGG - Intronic
919031662 1:192250875-192250897 AAGACCACCTTGCTGAAATAAGG - Intergenic
922500188 1:226091529-226091551 AAGGGCATCTTGATGAGATATGG - Intergenic
1063318041 10:5025672-5025694 AATGCCAGCTTGATGAGATAAGG + Intronic
1063981133 10:11452757-11452779 AAGTGCCCCCAGATGAAATATGG - Intergenic
1066218381 10:33310984-33311006 CAGTCCCCTTTGAAGAGATAAGG + Intronic
1067766531 10:49091502-49091524 AAGTCCCCTTTGATGGGACCTGG + Intronic
1068327555 10:55514333-55514355 AACTACCACTTGATGAGATTTGG + Intronic
1074636192 10:115320624-115320646 AAGACCACCTTGCTGAAATAAGG - Intronic
1081809419 11:45906747-45906769 AAGTCACCCTTGAACAGATGTGG + Intronic
1082906529 11:58313100-58313122 AAGTTTCCCTTGCTGAGATAGGG + Intergenic
1085734231 11:79025226-79025248 AAGTCTTCCTGGATGTGATAGGG - Intronic
1085850223 11:80110751-80110773 AAGACCACCTTGCTGAAATAAGG + Intergenic
1090613790 11:128496491-128496513 AAGTCCCAGTTTAGGAGATAAGG + Intronic
1091155428 11:133367366-133367388 CAGTCTCCCTTGATGAGCTGAGG - Intronic
1092639930 12:10494660-10494682 AAGACCACCTTGCTGAAATAAGG + Intergenic
1093413520 12:18894956-18894978 AAGACCACCTTGCTGAAATAAGG - Intergenic
1098669939 12:73214687-73214709 AAGTCACCCTTGAAGACTTATGG + Intergenic
1099284421 12:80699000-80699022 AAGTTCCCTTTTATGAGATTGGG + Intergenic
1099684167 12:85864928-85864950 AAGTCCACCTTGCTGAAATAAGG - Intergenic
1099958729 12:89376611-89376633 AAGATCCCTTTGGTGAGATATGG - Intergenic
1099985796 12:89662102-89662124 TAGTCTCTCTTGATAAGATATGG - Intronic
1100028259 12:90154582-90154604 AAGACCACCTTGCTGAAATAAGG + Intergenic
1100941240 12:99724413-99724435 AAGACCACCTTGCTGAAATAAGG + Intronic
1104803834 12:131572400-131572422 ACGTCCCCCTTAAAGAGAAAGGG - Intergenic
1104824109 12:131696085-131696107 ACGTCCTGCTTGAGGAGATACGG - Intergenic
1107264351 13:38535232-38535254 AAGTCTCCCATTCTGAGATAGGG + Intergenic
1107747050 13:43521456-43521478 CAGTCCCCCTTGATGAGAGCGGG - Intronic
1107830280 13:44369172-44369194 CAGTTCCCCTTAGTGAGATAAGG + Intergenic
1108144810 13:47464996-47465018 AAGACCACCTTGCTGAAATAAGG + Intergenic
1110790352 13:79580914-79580936 AAGACCACCTTGCTGAAATAAGG - Intergenic
1114129375 14:19772089-19772111 AAGTTCCCCTTGCAGAGAAAGGG - Intronic
1115928691 14:38466776-38466798 AAGACCACCTTGCTGAAATAAGG - Intergenic
1118479048 14:66145079-66145101 AAGACCACCTTGCTGAAATAAGG + Intergenic
1121370078 14:93348793-93348815 AAGTCCCCATTACAGAGATAAGG - Intronic
1122076001 14:99234995-99235017 AAGTCCCTCTAGAAGAGAGACGG - Intronic
1123608949 15:22068903-22068925 AAGTTCCCCTTGCAGAGAAAAGG - Intergenic
1126284440 15:46995534-46995556 AAGACCACCTTGTTGAAATAAGG - Intergenic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1126808101 15:52373529-52373551 AGGTTCCCCTTCATGAGATTTGG - Intronic
1127687549 15:61363836-61363858 AAGACCACCTTGCTGAAATAAGG - Intergenic
1129285251 15:74519353-74519375 AAGTTCCTTTTGGTGAGATAAGG + Intergenic
1129775547 15:78234044-78234066 AAGTCCCCCTTGAGGAGACAGGG + Intronic
1130805108 15:87312760-87312782 AAGTTACACTTGAGGAGATATGG + Intergenic
1202981190 15_KI270727v1_random:360703-360725 AAGTTCCCCTTGCAGAGAAAAGG - Intergenic
1136645467 16:31610031-31610053 AAGACCACCTTGCTGAAATAAGG + Intergenic
1137712859 16:50578807-50578829 AAGCAGCCCCTGATGAGATAAGG - Intronic
1139729085 16:68927150-68927172 CAGTCTCCCTTGAAAAGATAAGG - Intronic
1139770691 16:69273853-69273875 AAGTGCACCCTAATGAGATAGGG + Intronic
1140764679 16:78146031-78146053 AAGTCCCCCTTGCCCTGATAAGG + Intronic
1142553309 17:753843-753865 AAATCAGCCTTGAAGAGATAAGG - Intronic
1142911725 17:3098937-3098959 AAGACCACCTTGCTGAAATAAGG + Intergenic
1147332348 17:39706376-39706398 GAGTCCCCCATGAAGAGAAAAGG - Intronic
1149229552 17:54517888-54517910 AAGACCACCTTGCTGAAATAAGG - Intergenic
1149377806 17:56063481-56063503 AAGACCACCTTGCTGAAATAAGG - Intergenic
1154464990 18:14635151-14635173 AAGACCACCTTCTTGAGATAAGG + Intergenic
1156181441 18:34609684-34609706 AATTCCACCTTCATGAGATAAGG - Intronic
1156230606 18:35150921-35150943 AAGACCACCTTGCTGAAATAAGG - Intergenic
1156774573 18:40771400-40771422 AAGGCCCGATTGATGAGAGAGGG - Intergenic
1158105501 18:53881552-53881574 AAGTCCACCTTGCTGAAATAAGG - Intergenic
1162131267 19:8527467-8527489 AAGTCCCGCTTGATGGGCTGTGG + Exonic
1162893235 19:13748788-13748810 AAGTGCCCCTTGAGGCGTTAGGG - Intronic
1164965294 19:32478063-32478085 AAGTCCCACATGATGTGGTAGGG - Intronic
1168027382 19:53652474-53652496 AAGTCCCCCTTGGTTAAAAATGG + Intergenic
930023451 2:47015092-47015114 AAGTTCCCCTTGGTGAGGGAGGG + Intronic
933324381 2:80816553-80816575 AAGACCACCTTGCTGAAATAAGG + Intergenic
937841715 2:126530949-126530971 AAGTCCTCTTTCATGAGATCAGG + Intergenic
937893812 2:126962331-126962353 AAGACCACCTTGCTGAAATAAGG - Intergenic
938224147 2:129601317-129601339 AAGACCACCTTGCTGAAATAAGG - Intergenic
939260064 2:139795645-139795667 AACTCCCACTTGAGGATATAGGG + Intergenic
941904408 2:170707093-170707115 AAGTACCACTTGATGTGAGAAGG - Intergenic
943514184 2:188863657-188863679 AAGACCACCTTGCTGAAATAAGG + Intergenic
945439599 2:209863568-209863590 AAGACCACCTTGCTGAAATAAGG - Intronic
947033648 2:225825983-225826005 AAGACCACCTTGCTGAAATAAGG + Intergenic
947311421 2:228808065-228808087 AAGACCACCTTGCTGAAATAAGG - Intergenic
1169695624 20:8384255-8384277 AAGACCACCTTGCTGAAATAAGG - Intronic
1169979087 20:11363544-11363566 AAGACCACCTTGCTGAAATAAGG - Intergenic
1176809547 21:13523233-13523255 AAGACCACCTTCTTGAGATAAGG - Intergenic
1177133330 21:17283164-17283186 AATACTACCTTGATGAGATAAGG + Intergenic
1177878787 21:26668297-26668319 AAGACCACCTTGCTGAAATAAGG - Intergenic
1181394697 22:22612757-22612779 AAGTTCCCTTTGATGACATCAGG + Intergenic
949315516 3:2750559-2750581 AAGTCCCCCTTGATGAGATATGG + Intronic
949944842 3:9181734-9181756 AAGGCCCACGTGATTAGATAGGG + Intronic
951944414 3:28118579-28118601 AAGTCCCACTTGATGGAATTAGG - Intergenic
952294544 3:32049610-32049632 AAGTCCCCCTTGCTTAAAAATGG + Intronic
956767978 3:72500513-72500535 AAGTCCCGCTTGATGAAATTTGG - Intergenic
957268741 3:78002255-78002277 AAGACCACCTTGCTGAAATAAGG - Intergenic
957584192 3:82113619-82113641 AAGACCACCTTGCTGAAATAAGG - Intergenic
958481802 3:94653192-94653214 AAGACCACCTTGCTGAAATAAGG - Intergenic
958919547 3:100089005-100089027 AAGTATCCTTTGATGAAATAAGG + Intronic
959830715 3:110858507-110858529 AAGTCCGCCTTAATGAGGCATGG + Intergenic
962414354 3:135168629-135168651 AGGTCGCCCTTGAGGAAATACGG - Intronic
962692087 3:137908702-137908724 AAGACCACCTTGCTGAAATAAGG + Intergenic
962971781 3:140408214-140408236 AAGTTACCCTTGAAGAGAAAAGG + Intronic
963401585 3:144805722-144805744 AAGACCACCTTGCTGAAATAAGG - Intergenic
964066826 3:152590204-152590226 AAGTTCTCCTTGATGAAAGAAGG + Intergenic
966539491 3:181074083-181074105 AAGACCACCTTGCTGAAATAAGG - Intergenic
968015901 3:195332563-195332585 AAGTCCTCCTTGATATGATTTGG + Intronic
969132358 4:5001093-5001115 AAGACCACCTTGCTGAAATAAGG - Intergenic
970288074 4:14540337-14540359 AAGACCACCTTGCTGAAATAAGG + Intergenic
970563187 4:17303482-17303504 TTGTCCCCCTGGATAAGATAAGG - Intergenic
970787690 4:19819158-19819180 AATTCCACCTTGTTGTGATAAGG - Intergenic
971418882 4:26457541-26457563 AAGTCCACCATGAGGAGATCTGG - Intergenic
971516783 4:27497218-27497240 AAGTCTACCTTGCTGAAATAAGG + Intergenic
972793050 4:42391292-42391314 AAATGCCCCTTGCTGAGAAAGGG + Intergenic
976204333 4:82610141-82610163 AAGTGCCTCTGGCTGAGATAGGG + Intergenic
979628375 4:122872282-122872304 AAGACCACCTTGCTGAAATAAGG + Intronic
979775581 4:124584478-124584500 AAGACCACCTTGCTGAAATAAGG + Intergenic
980400410 4:132277043-132277065 AAGACCTCCTTGCTGAAATAAGG + Intergenic
980489533 4:133506930-133506952 AAGACCACCTTGCTGAAATAAGG + Intergenic
980855366 4:138432779-138432801 AAGCCCACCTTGCTGAAATAAGG + Intergenic
980864994 4:138543619-138543641 AAGACCACCTTGCTGAAATAAGG + Intergenic
981012461 4:139939542-139939564 AAGACCCCCTTGTTGAGAATAGG - Intronic
983727078 4:170941673-170941695 AAGACCACCTTGCTGAAATAAGG + Intergenic
986140804 5:5027634-5027656 AAGACCACCTTGCTGAAATAAGG + Intergenic
987988440 5:25180187-25180209 AAGGCCACCTTGCTGAAATAAGG - Intergenic
993344994 5:86771657-86771679 AAGTCCTCCTGGATAACATAGGG + Intergenic
993957522 5:94254014-94254036 AAGGCCCTCCTGATGAGATTAGG - Intronic
995003735 5:107165743-107165765 CAGTTCCACTTAATGAGATAAGG - Intergenic
996965711 5:129305440-129305462 AAGACCACCTTGCTGAAATAAGG - Intergenic
997067658 5:130581011-130581033 AAGACCACCTTGCTGAAATAAGG + Intergenic
997097587 5:130930439-130930461 AAGACCACCTTGCTGAAATAAGG + Intergenic
998755480 5:145374714-145374736 AAGGCCACCTTGCTGAAATAAGG - Intergenic
1007471296 6:42092311-42092333 AATTCCACCTCTATGAGATAAGG - Intergenic
1009740099 6:67733289-67733311 AAGACCACCTTGCTGAAATAAGG - Intergenic
1011944315 6:92881653-92881675 AAGACCACCTTGCTGAAATAAGG + Intergenic
1012434693 6:99203098-99203120 AAGACCACCTTGCTGAAATAAGG - Intergenic
1015358331 6:132306271-132306293 AAGGCCACCTTGCTGAAATAAGG + Intronic
1015410710 6:132890939-132890961 AAGACCACCTTGCTGAAATAAGG - Intergenic
1016516033 6:144893917-144893939 CGGTCCTCCTTGTTGAGATAAGG - Intergenic
1020557872 7:9692361-9692383 AAGACCACCTTGCTGAAATAAGG + Intergenic
1020633651 7:10671159-10671181 AAGACCACCTTGCTGAAATAAGG - Intergenic
1022634791 7:32121138-32121160 AAGACCACCTTGCTGAAATAAGG + Intronic
1023604322 7:41914869-41914891 AAGTAACCCTCGAGGAGATAAGG - Intergenic
1028991865 7:97057601-97057623 AAGACCACCTTGATGAAACAAGG + Intergenic
1029609137 7:101617442-101617464 AAGTCCCCACTGATAAGAGAAGG + Intronic
1029695709 7:102211905-102211927 AAGTCCCGGCTGATGAGATGAGG + Intronic
1032991735 7:137401797-137401819 AAATCCCTATTGAGGAGATATGG + Intronic
1037849395 8:22314313-22314335 ATCTTCCCCTTGAGGAGATAAGG - Exonic
1038394768 8:27238607-27238629 AAGTCTCTCTTGATGACAAAAGG + Intronic
1042630096 8:70806675-70806697 AAGACCACCTTGCTGAAATAAGG + Intergenic
1045705298 8:104915738-104915760 AAGACCACCTTGCTGAAATAAGG - Intronic
1052369386 9:27646589-27646611 AAGACCACCTTGCTGAAATAAGG + Intergenic
1052546794 9:29890016-29890038 AAGACCACCTTGCTGAAATAGGG + Intergenic
1052892875 9:33720127-33720149 AAGGCCACCTTGAGGATATAGGG - Intergenic
1054836800 9:69683888-69683910 AAGTCACTCTTAATAAGATATGG + Intergenic
1057925383 9:99142317-99142339 AAGCCCCTCTTCTTGAGATAAGG - Intronic
1059596432 9:115725233-115725255 AAGACCACCTTGCTGAAATAAGG + Intergenic
1192952065 X:76027515-76027537 AAGACCACCTTGCTGAAATAAGG + Intergenic
1192997913 X:76532132-76532154 GAGTCCACCTTGCTGAAATAAGG - Intergenic
1193055464 X:77144823-77144845 AAGACCACCTTGCTGAAATAAGG + Intergenic
1193768397 X:85560149-85560171 AAGACCACCTTGCTGAGATAAGG - Intergenic
1194523274 X:94944006-94944028 AAGACCACCTTGCTGAAATAAGG + Intergenic
1194596859 X:95869027-95869049 AAGACCACCTTGCTGAAATAAGG + Intergenic
1195435776 X:104842121-104842143 AAGACCACCTTGCTGAAATAAGG - Intronic
1195686222 X:107588810-107588832 AAGACCACCTTGCTGAAATAAGG - Intronic
1197029963 X:121801895-121801917 AAGACCACCTTGCTGAGGTAAGG - Intergenic
1199801367 X:151254137-151254159 AAGACCACCTTGCTGAAATAAGG + Intergenic