ID: 949319464 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:2792744-2792766 |
Sequence | CACCCTATTCTCTCTCACAA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 216 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 20, 4: 195} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
949319464_949319471 | 16 | Left | 949319464 | 3:2792744-2792766 | CCCTTGTGAGAGAGAATAGGGTG | 0: 1 1: 0 2: 0 3: 20 4: 195 |
||
Right | 949319471 | 3:2792783-2792805 | AGTTTAGGCTGTTTTGAAATGGG | 0: 1 1: 1 2: 2 3: 18 4: 231 |
||||
949319464_949319468 | 1 | Left | 949319464 | 3:2792744-2792766 | CCCTTGTGAGAGAGAATAGGGTG | 0: 1 1: 0 2: 0 3: 20 4: 195 |
||
Right | 949319468 | 3:2792768-2792790 | GAGAGAGAAATCCTTAGTTTAGG | 0: 1 1: 0 2: 3 3: 23 4: 306 |
||||
949319464_949319470 | 15 | Left | 949319464 | 3:2792744-2792766 | CCCTTGTGAGAGAGAATAGGGTG | 0: 1 1: 0 2: 0 3: 20 4: 195 |
||
Right | 949319470 | 3:2792782-2792804 | TAGTTTAGGCTGTTTTGAAATGG | 0: 1 1: 0 2: 1 3: 27 4: 239 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
949319464 | Original CRISPR | CACCCTATTCTCTCTCACAA GGG (reversed) | Intronic | ||