ID: 949319464

View in Genome Browser
Species Human (GRCh38)
Location 3:2792744-2792766
Sequence CACCCTATTCTCTCTCACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949319464_949319471 16 Left 949319464 3:2792744-2792766 CCCTTGTGAGAGAGAATAGGGTG 0: 1
1: 0
2: 0
3: 20
4: 195
Right 949319471 3:2792783-2792805 AGTTTAGGCTGTTTTGAAATGGG 0: 1
1: 1
2: 2
3: 18
4: 231
949319464_949319468 1 Left 949319464 3:2792744-2792766 CCCTTGTGAGAGAGAATAGGGTG 0: 1
1: 0
2: 0
3: 20
4: 195
Right 949319468 3:2792768-2792790 GAGAGAGAAATCCTTAGTTTAGG 0: 1
1: 0
2: 3
3: 23
4: 306
949319464_949319470 15 Left 949319464 3:2792744-2792766 CCCTTGTGAGAGAGAATAGGGTG 0: 1
1: 0
2: 0
3: 20
4: 195
Right 949319470 3:2792782-2792804 TAGTTTAGGCTGTTTTGAAATGG 0: 1
1: 0
2: 1
3: 27
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949319464 Original CRISPR CACCCTATTCTCTCTCACAA GGG (reversed) Intronic