ID: 949324238

View in Genome Browser
Species Human (GRCh38)
Location 3:2846016-2846038
Sequence CCTTAAGAAGGTGTGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 267}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949324231_949324238 8 Left 949324231 3:2845985-2846007 CCATTTTTGTCTTCAGTAATCAA 0: 1
1: 0
2: 3
3: 47
4: 436
Right 949324238 3:2846016-2846038 CCTTAAGAAGGTGTGGGAGCAGG 0: 1
1: 0
2: 2
3: 38
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949324238 Original CRISPR CCTTAAGAAGGTGTGGGAGC AGG Intronic
900561557 1:3309609-3309631 CCTGGAGAAGGTGCTGGAGCGGG + Intronic
901880287 1:12189841-12189863 CCTGCAGGAGGTGAGGGAGCAGG + Intronic
901946855 1:12711247-12711269 CCTAAAGAGTTTGTGGGAGCAGG - Intergenic
903656456 1:24951528-24951550 CAGTAAGAAGGTGGTGGAGCTGG + Intronic
904046698 1:27613350-27613372 CCTGGAGAAGATGGGGGAGCAGG + Exonic
904398039 1:30236235-30236257 CAATAGGAATGTGTGGGAGCTGG - Intergenic
904852039 1:33466773-33466795 CCTTCAGAATGTGGGGGTGCTGG + Intergenic
905323642 1:37134781-37134803 TATTGAGAAGGTGTGGGAGGAGG + Intergenic
905656616 1:39690057-39690079 CCTGGAGAATGTGTGGGAGGAGG + Intronic
906053991 1:42900084-42900106 CCTTTGGATTGTGTGGGAGCTGG - Intergenic
906252135 1:44318828-44318850 GGTTAAGAATGTGTGGTAGCAGG - Intronic
906318898 1:44804770-44804792 CCTCATGAAGGTGTGAGGGCTGG + Exonic
906654876 1:47540819-47540841 TCTTATGCAAGTGTGGGAGCTGG - Intergenic
907089021 1:51707354-51707376 CATTAAGAAGGTATTGAAGCAGG - Intronic
907727403 1:57032471-57032493 CCTGAAGGATGTGTGGGAGAAGG - Intronic
908315749 1:62930603-62930625 CCTTCACAAAGTGTGGGAGTAGG + Intergenic
909808148 1:79897138-79897160 CCTCAAGTAGGTGTTAGAGCTGG + Intergenic
915238279 1:154501861-154501883 CCTGAAGACCGTGTCGGAGCGGG - Exonic
916015944 1:160750129-160750151 GCTGAAGAAGGTGTAGGACCTGG - Intronic
922141548 1:222893444-222893466 CCTTTGGCAGGTGTGGGATCCGG - Intronic
922657884 1:227401834-227401856 CCTTCAGATTGTGTGGGAGCTGG + Intergenic
922673418 1:227532501-227532523 CCTTCAGTTTGTGTGGGAGCTGG - Intergenic
923332218 1:232935567-232935589 CCTTACACAGTTGTGGGAGCTGG - Intergenic
924321439 1:242854959-242854981 CCTTTAGATTGTGTGGGAGCTGG - Intergenic
924825516 1:247534017-247534039 CCTGAAGAAGGTGAGGAAGGGGG - Intronic
1063629062 10:7717395-7717417 CAGTAAGAAGCTCTGGGAGCTGG + Intronic
1064002202 10:11673071-11673093 CCTGAAGAAGGTAAGGGAGTAGG + Intergenic
1065229197 10:23579664-23579686 GCTTATGCAGTTGTGGGAGCTGG + Intergenic
1065318466 10:24486680-24486702 CCTTAAGGAAGTGAGAGAGCAGG - Intronic
1065989485 10:30993689-30993711 CCTAATGGAGCTGTGGGAGCAGG + Intronic
1066725886 10:38393204-38393226 CCTAAAGAAAATGTGGGAGTAGG - Intergenic
1067094004 10:43286428-43286450 CTTTCAGAGGGAGTGGGAGCGGG + Intergenic
1067348212 10:45453708-45453730 CTGTAAGAAGGTGAGGGAGGTGG - Intergenic
1068240915 10:54299982-54300004 CTTTAAGAGTGTGTGGTAGCAGG - Intronic
1069731937 10:70622719-70622741 CTTTGAGGAGGTCTGGGAGCAGG + Intergenic
1070452839 10:76579250-76579272 CCCTAGGAAGGTGAGGGAGAAGG - Intergenic
1073212817 10:101818488-101818510 CCCAAAGAAGGCGGGGGAGCCGG - Intergenic
1074985837 10:118658832-118658854 CCTTCAGTTTGTGTGGGAGCTGG - Intergenic
1075547659 10:123367376-123367398 CCCTAATAAGGCATGGGAGCTGG - Intergenic
1075553232 10:123409479-123409501 CCCTAAGAAAGTGTAGAAGCTGG - Intergenic
1076526990 10:131118099-131118121 CCGTGGGCAGGTGTGGGAGCAGG - Intronic
1076670335 10:132117538-132117560 CATCAAGAAGGAGTGCGAGCGGG + Exonic
1077275325 11:1703335-1703357 CGTTATGTAGGTGTGGCAGCAGG + Intergenic
1077988127 11:7375917-7375939 CCTGAAGGAAGTGAGGGAGCAGG - Intronic
1078139127 11:8679274-8679296 CCTTTTGAAGGAGAGGGAGCTGG + Intergenic
1078712664 11:13809972-13809994 CCTGAAGGAGGTGAGGGAGCTGG + Intergenic
1078962459 11:16293620-16293642 CCTTAAGTAGGGGTGGGAGTGGG + Intronic
1081195241 11:40152624-40152646 CCTTCAGTTTGTGTGGGAGCTGG + Intronic
1083741603 11:64714221-64714243 CTTTGAGAGGGTGAGGGAGCGGG - Intronic
1084971976 11:72777026-72777048 CCTGGAGCAGGTGTGGGAGGGGG - Intronic
1085390822 11:76181324-76181346 CCTCAAGAAGGTGGTGGAGTAGG - Intergenic
1085752211 11:79171321-79171343 CCTTAAGAAGGAAAGGCAGCTGG + Intronic
1086508166 11:87527843-87527865 CCCTTGGAAGGTGTGGGATCTGG - Intergenic
1086527476 11:87745040-87745062 CCTTTAGAAGGTTTGGTAGGTGG + Intergenic
1088361122 11:108991156-108991178 CTTTAAGAATGAATGGGAGCAGG + Intergenic
1088603778 11:111509813-111509835 CCTTCAAAAGCTGTGGGAGATGG + Intronic
1089268031 11:117280905-117280927 CGTTGAGAAGAGGTGGGAGCAGG - Intronic
1089878196 11:121746419-121746441 CCTAATGGAGTTGTGGGAGCAGG + Intergenic
1090204901 11:124878687-124878709 CCATAGGAAGGTGTGGGAGAGGG - Exonic
1091931411 12:4398542-4398564 CCATAAGAAGGTGTGGCAATGGG + Intergenic
1092608372 12:10145224-10145246 CCTTAACAGTGTGTGGGAGTGGG + Intergenic
1093409295 12:18845396-18845418 CCTTTGGATTGTGTGGGAGCTGG - Intergenic
1096089585 12:48890010-48890032 CCTGAAGAAGAAGTAGGAGCTGG - Intergenic
1096347855 12:50866316-50866338 CCTTTGGATTGTGTGGGAGCTGG + Intronic
1096596073 12:52696357-52696379 CCTGAAGAAGGTGAGGGAAAGGG - Exonic
1096618246 12:52846751-52846773 CCTCAAGAAGGTGAGGGTGGGGG - Exonic
1097189552 12:57212924-57212946 CCTCAGGAAGCTGTGGGAGCGGG - Exonic
1097391060 12:59013797-59013819 CATGGAGAAGGTATGGGAGCGGG + Intergenic
1099130246 12:78819920-78819942 CCTTAAGCTGGTGTAGGAGCAGG - Intergenic
1099477189 12:83121959-83121981 CCTTCAGATCGTGTGGGAGCTGG - Intronic
1099946967 12:89255766-89255788 GATTTTGAAGGTGTGGGAGCAGG - Intergenic
1100164488 12:91901063-91901085 CCTTGAGAAGCTGTGAGAGGAGG + Intergenic
1100411780 12:94326099-94326121 CCGTAAGAAGGGGAGGGGGCTGG + Intronic
1101395071 12:104339827-104339849 ACTTGGGAAGGTGTGGGAGGAGG + Intronic
1101600552 12:106205852-106205874 CCTCAAGACCCTGTGGGAGCTGG + Intergenic
1102330455 12:112024789-112024811 ACTTAAGAAGGTGAGGGAGATGG + Intergenic
1103870227 12:124085915-124085937 CCTGAGGGAGGTGCGGGAGCTGG + Intronic
1104065844 12:125305159-125305181 CCTGAAGAAGTTGTAGGAGACGG - Intronic
1104232442 12:126898412-126898434 TCTTAAGAATGAGTGGGACCTGG + Intergenic
1104504528 12:129318930-129318952 CCTTCAGTTGGTGTGGGAGCTGG - Intronic
1105981323 13:25519193-25519215 CCTGAAGGAGGTGAAGGAGCAGG - Intronic
1108446722 13:50516804-50516826 CATTAAGAAGGTTTGGCTGCAGG - Intronic
1110668201 13:78143035-78143057 CTTTTAGAAAGTGTGGGAGAAGG + Intergenic
1110778122 13:79433229-79433251 CATTTAGCAGGTGTGGGATCCGG + Intergenic
1111072220 13:83184039-83184061 CCTGGAGCAGGGGTGGGAGCAGG + Intergenic
1111748532 13:92298128-92298150 CCTTCGGATTGTGTGGGAGCTGG - Intronic
1112573180 13:100612131-100612153 CCCAAGGAAGGGGTGGGAGCAGG - Intronic
1116346684 14:43803124-43803146 CCTTTGGATTGTGTGGGAGCTGG + Intergenic
1116620837 14:47201164-47201186 CCTCAAGAAGTTGATGGAGCAGG - Intronic
1116877109 14:50123139-50123161 CCTGAAGGAGGTAAGGGAGCAGG + Intronic
1117930995 14:60839903-60839925 CCTTTGGCAGGTGTGGGATCTGG + Intronic
1118837228 14:69485570-69485592 CCTTAAGACGGAGAGGGACCTGG + Intronic
1121245252 14:92457374-92457396 CCTGAAGAAGGTGAGGAAGTGGG - Intronic
1121516631 14:94556536-94556558 CCTTCAGATTGTTTGGGAGCTGG - Intergenic
1121717680 14:96087955-96087977 CCTTGGGAAGGTGTGGGGGGTGG - Exonic
1122312739 14:100807543-100807565 ACTTAAGAAGGGGTTGGGGCTGG - Intergenic
1122818741 14:104329125-104329147 CCTTATGAACGTGTAGGATCCGG + Intergenic
1123093183 14:105751199-105751221 CCTGAGGAAGGGGTGGGGGCAGG - Intergenic
1123543383 15:21317903-21317925 CATTAAGCAGGTGTGGTACCTGG - Intergenic
1123955230 15:25328061-25328083 CCTTAAGAAGGTGGAGGCCCAGG + Intergenic
1124667880 15:31609403-31609425 CCTTCAGATTGTGTGGGAGCTGG + Intronic
1125152354 15:36547159-36547181 CTTTCAGGAGGGGTGGGAGCGGG + Intergenic
1125269425 15:37921771-37921793 CCTTTAGATTGTGTGGGAACTGG - Intergenic
1126664817 15:51066763-51066785 CCCTAAGTAGCTGTGGGGGCAGG + Intronic
1126701952 15:51375910-51375932 CCTTCAGATGCTGTGGGGGCTGG + Intronic
1126948551 15:53852972-53852994 CCTTAAGTGGGTGGGGGAGGAGG - Intergenic
1127308118 15:57728027-57728049 CCTTAAGAAGGTGTGACTTCAGG - Intronic
1127533622 15:59869061-59869083 GCTCAAGAAAGTGTGGCAGCCGG + Intergenic
1128480502 15:68033591-68033613 CCTTAGGAAGGGGTGGGTGAAGG - Intergenic
1128738566 15:70067576-70067598 CCTTAGTAAGGTGTGAGATCTGG - Intronic
1132571029 16:644047-644069 CCCCAAGAAGGTGCAGGAGCAGG - Intronic
1132697104 16:1206928-1206950 GCGGAAGAAGGTGGGGGAGCGGG - Intronic
1134627844 16:15735523-15735545 CCTGAAGAAGATCCGGGAGCTGG - Exonic
1134915106 16:18062745-18062767 CCATTACAAGGTGAGGGAGCTGG - Intergenic
1138588768 16:57987939-57987961 CCCCCTGAAGGTGTGGGAGCAGG + Intronic
1138880990 16:61014737-61014759 CCTTAGGATTGTGTGGGAGCTGG + Intergenic
1139171049 16:64629261-64629283 CCTAAAGAAGAAGTGGGAGAAGG + Intergenic
1139301699 16:65950337-65950359 TGTTATGAAGGGGTGGGAGCAGG + Intergenic
1139561421 16:67744760-67744782 CCTTGTGAAGGAGTGGGAGCTGG + Intronic
1139690412 16:68638168-68638190 CCTGAAGGAGGTGAGGGAGAGGG + Intronic
1141618961 16:85226592-85226614 TCTTAATAAGGTGAGGGAGCAGG + Intergenic
1143465054 17:7131063-7131085 GCTGATGGAGGTGTGGGAGCCGG - Intergenic
1147114655 17:38289922-38289944 CCTAAACATGGTGTGGGAGGTGG + Intergenic
1148260939 17:46183129-46183151 CCTAAAGAATGAGTAGGAGCTGG + Intronic
1148372412 17:47110533-47110555 CCTTAAAAATGTGTGGTACCAGG - Intergenic
1150538935 17:66076390-66076412 CCTGAAGACTGTGTGGGAGCTGG + Intronic
1151125148 17:71836812-71836834 ACTCAAGAAGGGGTGGGTGCAGG + Intergenic
1152974171 18:197208-197230 CCTGAAGGAGGTGAGGGAGCTGG - Intronic
1154094064 18:11393761-11393783 CCTTCAGTTTGTGTGGGAGCTGG + Intergenic
1155699411 18:28724679-28724701 CCTTAAAGAGTTGTGGGTGCCGG + Intergenic
1157329633 18:46694124-46694146 CCTTAAGAAGGAGTGGGTGCTGG - Intronic
1158376322 18:56873481-56873503 CATAAAGAAGGTGGGGGACCAGG + Intronic
1158829737 18:61263998-61264020 CCTTTGGATTGTGTGGGAGCTGG + Intergenic
1163144130 19:15369377-15369399 CCTTCAGAATGGATGGGAGCAGG + Intronic
1165699295 19:37925372-37925394 CCTGAAGGAGGTGAGGGAGTGGG + Intronic
1165866577 19:38943037-38943059 CCTGAAGGAGGAGAGGGAGCCGG + Intronic
1166211460 19:41309236-41309258 CCTGAAGAACGAGTAGGAGCTGG - Intronic
1166299225 19:41904754-41904776 CCATAAGGAGGTGTGAGAGGTGG + Intronic
1166683244 19:44781012-44781034 CCTCCAGAAGGTGTGGGCGGGGG - Exonic
1166889170 19:45979856-45979878 CCTGAAGGAGGTGAGGGAGTGGG + Intergenic
926991895 2:18689185-18689207 CCTTCAGTAAATGTGGGAGCTGG - Intergenic
927879398 2:26679982-26680004 CCTTGAGAAGCTGGAGGAGCAGG + Intergenic
927889909 2:26741763-26741785 CCTTAGGAAGGGGAGGGAGTGGG + Intergenic
928180538 2:29065349-29065371 CCCTCAGAAGCTCTGGGAGCTGG + Intronic
928226664 2:29455180-29455202 CTTTCACAAGGTGTGGCAGCAGG + Intronic
928250303 2:29671539-29671561 CCCTAAGAAGGTGGAGAAGCTGG + Intronic
929449893 2:42029896-42029918 CTGTGAGAAGGTGTGAGAGCTGG - Intergenic
929667127 2:43841745-43841767 CTTTGAGAAGGGGAGGGAGCTGG - Intronic
929805985 2:45145375-45145397 CCTTCAGATTGTGTGGGAGCTGG + Intergenic
929925198 2:46201815-46201837 CCTGAAGAAGGTGGGGGTGGAGG + Intergenic
930059110 2:47273698-47273720 CCCGAGGAAGGTGAGGGAGCAGG - Intergenic
930208172 2:48609102-48609124 CCTTGAGGAGGTGTGGGGGAAGG - Intronic
930424561 2:51196228-51196250 ACTCAACAAGGTTTGGGAGCTGG - Intergenic
931874733 2:66499486-66499508 CTGTAAGAAGGTGTGGGGGAAGG - Intronic
933811073 2:86033094-86033116 CCTGAGGGTGGTGTGGGAGCAGG - Intronic
933848476 2:86346612-86346634 ACTTAAAAAAATGTGGGAGCTGG - Intergenic
934793198 2:97080969-97080991 GCTTAAGAAGCTTTGGGGGCTGG + Intergenic
936012145 2:108931596-108931618 CCTTAAGTAGCTGTGTGACCTGG - Intronic
938387267 2:130875798-130875820 CCAGAAGCAAGTGTGGGAGCCGG - Intronic
938625909 2:133109019-133109041 CCTTAACAAGATGTGGAAGAAGG - Intronic
938778165 2:134560095-134560117 CCTGAAGGAGGGGAGGGAGCAGG - Intronic
939088018 2:137744889-137744911 TCTTATGAAGGTGTTGGAGTAGG - Intergenic
940618706 2:156083938-156083960 CCTTCAGTTTGTGTGGGAGCTGG - Intergenic
941404946 2:165075636-165075658 CCCTTAGCAGGTGTGGGATCTGG + Intergenic
943891268 2:193290030-193290052 CCTTCAGTTTGTGTGGGAGCTGG - Intergenic
944432105 2:199644839-199644861 CTTTCAGATTGTGTGGGAGCTGG - Intergenic
944519122 2:200545786-200545808 ACTGAAGAAGGTGGGGAAGCTGG - Intronic
945075299 2:206032368-206032390 CCCTCAGATTGTGTGGGAGCTGG + Intronic
945198479 2:207258838-207258860 GCTCAAGAAGGGGTGGGGGCTGG + Intergenic
945482603 2:210360977-210360999 CCTTTGGATTGTGTGGGAGCTGG - Intergenic
1168876795 20:1177444-1177466 CCCTAAGGAGGTGAGGGAGTGGG + Intronic
1170694524 20:18646517-18646539 CCTAAAGCAGGTCTGGGAGTTGG + Intronic
1170799484 20:19579184-19579206 CCTTAGGAAAGAGTGGGAGAAGG + Intronic
1171348148 20:24481724-24481746 CCTAATGAATGTGTGGGAGCTGG + Intronic
1172023682 20:31933849-31933871 CCCAAAGAAGGTGAGGAAGCCGG + Exonic
1172945677 20:38686775-38686797 CCTTAAATATGTGTGGGAGAGGG + Intergenic
1173676000 20:44836188-44836210 CCTTAGGAGGGATTGGGAGCTGG - Intergenic
1177525392 21:22284056-22284078 CCTTAAAAAGCTATGGGATCAGG + Intergenic
1178595710 21:33950524-33950546 CCTTCAGTAGGTGTGTCAGCGGG - Intergenic
1179075876 21:38121318-38121340 CCTTAAGGATGTCTGAGAGCTGG - Exonic
1180141408 21:45895757-45895779 CCTGACCAGGGTGTGGGAGCCGG - Intronic
1181476119 22:23168763-23168785 CCCCAGGAAGGTGAGGGAGCAGG + Intergenic
1182439456 22:30354224-30354246 CCAGAGGAAGGTGTGGGAGAAGG - Intronic
1182547607 22:31085038-31085060 CCTCAAGAATGTGCGGGAGCCGG - Intronic
1183186722 22:36295662-36295684 CCTCAAGAAGATCCGGGAGCTGG - Exonic
1183474527 22:38028742-38028764 CCTTCAGAGGGTGTGTGTGCAGG - Intronic
1183641054 22:39092704-39092726 CCCTAGGAAGGGTTGGGAGCCGG - Intergenic
1184566495 22:45295162-45295184 CCTAAAGAAGGTGTGTGGGCTGG - Intronic
1185224219 22:49643906-49643928 CCTTAGGATGGGGTGGGGGCAGG - Intronic
949250006 3:1972675-1972697 ACTTAAGATGGTGGGGAAGCTGG - Intergenic
949324238 3:2846016-2846038 CCTTAAGAAGGTGTGGGAGCAGG + Intronic
950659333 3:14457081-14457103 CCATAAGAATGTCTGGGAGTAGG + Intronic
951022628 3:17797620-17797642 CCTTGCGTAGTTGTGGGAGCTGG + Intronic
951183768 3:19688639-19688661 CCTTCAGATTGTGTGGGAGCTGG + Intergenic
951187845 3:19734979-19735001 CCTTAAGTAATTGTGGGAGCTGG - Intergenic
951269591 3:20608200-20608222 CCTTCAGTTTGTGTGGGAGCTGG + Intergenic
953610084 3:44440264-44440286 ACTTTAAAAGGTGTGGTAGCTGG + Exonic
953679545 3:45029129-45029151 CCTGAGGAAGCTGTGGGAGTAGG - Intronic
953723975 3:45381699-45381721 CCTTCAGATGGCATGGGAGCTGG - Intergenic
954116566 3:48469891-48469913 CCTTGGGAAGGTGTGGATGCTGG - Intronic
954416747 3:50397015-50397037 CCCTAAGAGGGTGAAGGAGCTGG - Intronic
955632050 3:60985166-60985188 CATCAAGAAGGTGTGGGAGGAGG - Intronic
955810715 3:62785590-62785612 CCTTGAGCAGGTATGGGAGCAGG - Intronic
958969965 3:100600775-100600797 CCTTCAGATTGCGTGGGAGCTGG - Intergenic
960703811 3:120462683-120462705 CCTGAAGAAGGTGATGGTGCTGG - Intergenic
962759482 3:138496099-138496121 CCTTAAGTAGGGCTGGGATCTGG - Intronic
964769327 3:160208209-160208231 CCTTCAGAATGTCTGGAAGCTGG - Intergenic
964892191 3:161550741-161550763 CATTGAGAAGGTCTGTGAGCAGG - Intergenic
965321915 3:167261637-167261659 CCTTCAGTTTGTGTGGGAGCTGG - Intronic
966222544 3:177565286-177565308 GCTTAACACTGTGTGGGAGCTGG + Intergenic
966992035 3:185242684-185242706 CCTTTGGATTGTGTGGGAGCTGG - Intronic
967257538 3:187609140-187609162 CCTTCAGATTGTGTGGGAGCTGG - Intergenic
968501026 4:950158-950180 CCTGGAGAAGGGGTGGGGGCTGG + Intronic
968863585 4:3192720-3192742 CCTTAAAAAGGGATGGGAGCAGG + Intronic
970312044 4:14792991-14793013 CCTTCAGATTGTGTGGGAGCTGG + Intergenic
970617586 4:17781934-17781956 ACTCAAGGAGGTGTGGGATCCGG + Intergenic
970996070 4:22268804-22268826 CCTTCAGATTGTGTGGGAGTTGG + Intergenic
972189094 4:36568749-36568771 CCTTCAGATTGCGTGGGAGCTGG - Intergenic
976849048 4:89524175-89524197 CCTGAAGAAGCAGTGGGAGTAGG + Intergenic
978847546 4:113292112-113292134 CCTTAAGAAGGTGAAGGGGGTGG - Intronic
979253700 4:118590700-118590722 CCTTAAGCAATTGTGGGAGCTGG - Intergenic
979335803 4:119460621-119460643 CCTAAAGAAAATGTGGGAGTAGG + Intergenic
979808170 4:125001366-125001388 CCTTATGCATTTGTGGGAGCTGG + Intergenic
980156822 4:129117771-129117793 CCTTAAGCAGGGGTGGGGGTTGG - Intergenic
981400995 4:144313709-144313731 CCTTTAGTTTGTGTGGGAGCTGG - Intergenic
982218788 4:153107210-153107232 CCTTTGGATTGTGTGGGAGCTGG - Intergenic
983918360 4:173316308-173316330 CTTGAAGGAGGTGTGAGAGCTGG - Intronic
985658950 5:1146196-1146218 CCTCAAGAAGGTGGGTGACCAGG - Intergenic
987577701 5:19752362-19752384 CCTTTGGATTGTGTGGGAGCTGG + Intronic
991386928 5:66101036-66101058 CCTTCAGTTTGTGTGGGAGCTGG + Intergenic
992100000 5:73397910-73397932 TCTTGAGCAAGTGTGGGAGCTGG - Intergenic
993917027 5:93756059-93756081 CCTTCAGTATGTGTGGGAGCTGG + Intronic
995473033 5:112523429-112523451 CCTTCAGTTTGTGTGGGAGCTGG - Intergenic
995540088 5:113177095-113177117 CCTGAAGATGGTGTGGGGGTGGG - Intronic
995722482 5:115151213-115151235 CCTTTGGACTGTGTGGGAGCTGG + Intronic
996288962 5:121829159-121829181 CCTTCAGATTGTGTGGGAGCTGG - Intergenic
997382569 5:133448333-133448355 CCTTCAGACGGTGTGGGTGCTGG - Intronic
998094497 5:139389630-139389652 GCTTGAGAAGGGGTGTGAGCAGG + Intronic
1000756127 5:165162337-165162359 CCTATAGAAGGTGGGGGAGGTGG - Intergenic
1004339876 6:14798768-14798790 CCTTTAGAAGCTGTGTGAGGAGG - Intergenic
1005234435 6:23743472-23743494 CCATAAGCAATTGTGGGAGCTGG + Intergenic
1006709086 6:36049786-36049808 CCTTGAGAAGATGAGGGAGGTGG + Intronic
1008493361 6:52108401-52108423 CCTTCAGGAGGCGAGGGAGCAGG - Intergenic
1009798501 6:68502779-68502801 CCTTCAGATTGGGTGGGAGCTGG + Intergenic
1009808984 6:68636514-68636536 CTTAAAGAAGGGGTGGGGGCGGG - Intronic
1010165131 6:72906204-72906226 CCTTCAGATTGTGTGGAAGCTGG - Intronic
1011579521 6:88844018-88844040 CCTTCAGGATGTGTAGGAGCAGG + Intronic
1011706151 6:90003344-90003366 CCTGGAGCAGGTGAGGGAGCTGG - Intronic
1014304845 6:119727627-119727649 TCTTCAGATTGTGTGGGAGCTGG - Intergenic
1015205926 6:130638565-130638587 GCTTAAGAAGTTTTGGGGGCCGG - Intergenic
1015333222 6:132005585-132005607 CCTCAAGAAGGTGGAGGAGCAGG + Intergenic
1016435812 6:144035960-144035982 CTTTAAGGAGGTGGAGGAGCAGG + Intronic
1016792102 6:148076804-148076826 CCTGGAAAAGGTGTGGGACCTGG + Intergenic
1017994895 6:159523492-159523514 CCTTAAGGGGGTGGGGGGGCGGG - Intergenic
1020700886 7:11481849-11481871 CCCTGAGCAGGTGTGTGAGCAGG + Exonic
1021848019 7:24781223-24781245 CGTCTAGAAGGTGTGGGTGCTGG + Intergenic
1021978388 7:26030980-26031002 CCTGAAGAAGGTGAGGGAGCGGG + Intergenic
1023004181 7:35845102-35845124 CCTTAAGAACTTGTGGGTGTAGG + Intronic
1023112800 7:36831162-36831184 TCTTCAGAAAGTGTGGGGGCAGG - Intergenic
1023410554 7:39885514-39885536 CCTAAAGAAAGTTTGGGGGCCGG + Intergenic
1024068001 7:45759266-45759288 CCTAAAGAAAATGTGGGAGTAGG - Intergenic
1024669308 7:51577628-51577650 CCTTCAGATCATGTGGGAGCTGG - Intergenic
1024942854 7:54780300-54780322 CCTTCAGAAGGAGTGGGAGTGGG + Intergenic
1027305519 7:76892321-76892343 CTGTAGGAAGGTGGGGGAGCTGG + Intergenic
1029970123 7:104780449-104780471 CCTTACAAAGCTGTGGGAGAAGG - Intronic
1030107338 7:105998024-105998046 CCAAAAGAAGGAGTGGGGGCAGG + Intronic
1032099974 7:128967239-128967261 TCTTAAGGAGGTGTGGGATGTGG - Intronic
1032762852 7:134960611-134960633 CTTACAGAAGGTTTGGGAGCAGG - Exonic
1032998543 7:137477125-137477147 ACTGAAGAATGTGTGGGGGCAGG - Intronic
1033470925 7:141648081-141648103 CCTGAAGGAGGTGAGGGAGCCGG - Intronic
1037473951 8:19237891-19237913 CCTGAAGATGCTGTGGTAGCAGG - Intergenic
1041227744 8:55717038-55717060 CCTTCAGTTTGTGTGGGAGCTGG + Intronic
1043040769 8:75259514-75259536 CCTTTGGACTGTGTGGGAGCAGG + Intergenic
1044613713 8:94118985-94119007 CTTTAAGAATGGGTTGGAGCTGG + Intergenic
1045270734 8:100659043-100659065 ACATAAGAAGGTGTGGGGGCTGG + Intronic
1047732420 8:127737904-127737926 CCTTAAGAAGCCGCGGGAGGTGG - Intronic
1049248761 8:141577114-141577136 TCTTAAGAAAGAGTGGGGGCTGG - Intergenic
1050449268 9:5762692-5762714 CATTAAGAAGGTATGGGATGAGG + Intronic
1050812048 9:9760444-9760466 AGTTAAGAAGGTATTGGAGCAGG - Intronic
1051871464 9:21742466-21742488 CCTGAAGAAGGTGAGGGAAAGGG + Intergenic
1054779796 9:69155802-69155824 CCTTAAGAGGATGTGGCAGAAGG + Intronic
1055834120 9:80419077-80419099 GCTTAATGAGGAGTGGGAGCTGG + Intergenic
1056671076 9:88627321-88627343 CCTCATGTAGGGGTGGGAGCTGG + Intergenic
1060600755 9:124875886-124875908 CCTTAAGGTGGTGTGGGTGCTGG + Intronic
1061189087 9:129071297-129071319 CCTAATGAAGGTGGGGAAGCTGG - Exonic
1062674356 9:137731741-137731763 CCCTCGGAAGGTGTGGGATCTGG - Intronic
1185745809 X:2572564-2572586 CTTTAAGAATGGGTGGGGGCTGG + Intergenic
1187334788 X:18372663-18372685 CCTAGTGGAGGTGTGGGAGCAGG + Intergenic
1187869232 X:23750713-23750735 CATGAAGGAGGTGTGGGAGCAGG - Intronic
1188429938 X:30095073-30095095 TCTTAAGAAGGTGTGGGTCGGGG + Intergenic
1189962140 X:46333789-46333811 CCTTCGGTATGTGTGGGAGCTGG + Intergenic
1190632143 X:52398661-52398683 CCTTCAGATTGTGTGGGAACTGG - Intergenic
1190766727 X:53481320-53481342 CCTTAGCAGGGTGTGAGAGCGGG - Intergenic
1192820194 X:74636984-74637006 CCTTCAGATTGCGTGGGAGCTGG + Intergenic
1193643909 X:84044155-84044177 CCTTCAGTTTGTGTGGGAGCTGG - Intergenic
1193939139 X:87658450-87658472 CCTTGAGAAGGGGTAGCAGCAGG - Intronic
1195019500 X:100812567-100812589 CCTTCAGTTTGTGTGGGAGCTGG - Intergenic
1196021126 X:110992148-110992170 CCTAAAGGAGGTGAGGGAGTAGG + Intronic
1196225201 X:113158020-113158042 CCTTTGGATTGTGTGGGAGCTGG - Intergenic
1196948293 X:120850398-120850420 CCTTCGGATTGTGTGGGAGCTGG - Intergenic
1197664626 X:129210550-129210572 CCTTTGGATTGTGTGGGAGCTGG - Intergenic
1198167743 X:134073905-134073927 CCTTAAGTATGTGTTGGAGCAGG - Intergenic
1198485801 X:137086493-137086515 TCATAAGATGCTGTGGGAGCAGG - Intergenic
1200683423 Y:6239578-6239600 CCAAAAAAAGGTTTGGGAGCTGG + Intergenic
1201049211 Y:9914807-9914829 CCAAAAAAAGGTTTGGGAGCTGG - Intergenic
1201315782 Y:12644052-12644074 CCTTAGGATTGTGTGGAAGCTGG + Intergenic
1201373960 Y:13296008-13296030 CCCAATGGAGGTGTGGGAGCAGG - Intronic
1201947453 Y:19527052-19527074 CCTTAAGAGGGACTGGGAACTGG + Intergenic