ID: 949325813

View in Genome Browser
Species Human (GRCh38)
Location 3:2862997-2863019
Sequence TAGGCTGGAGCACCAAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949325813_949325821 26 Left 949325813 3:2862997-2863019 CCCCTTTTTGGTGCTCCAGCCTA 0: 1
1: 0
2: 1
3: 11
4: 158
Right 949325821 3:2863046-2863068 TATCTTTAAAATGAAGAAATAGG 0: 1
1: 1
2: 21
3: 203
4: 1531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949325813 Original CRISPR TAGGCTGGAGCACCAAAAAG GGG (reversed) Intronic
902892196 1:19452468-19452490 TTAGCCTGAGCACCAAAAAGAGG + Intronic
907990091 1:59572400-59572422 AAGGCTGGAGAAGCAAAAAGGGG + Intronic
908971726 1:69843227-69843249 TAGTATAGAGCATCAAAAAGAGG + Intronic
909137372 1:71818301-71818323 TAGACTGGATCAACAAAATGTGG + Intronic
915007650 1:152655203-152655225 TAGGCTGGGACTCCATAAAGCGG - Intergenic
915380327 1:155434132-155434154 TAGCCTGGGGTACCAAAATGGGG - Intronic
915810622 1:158906397-158906419 TGGGCTGGAGTAACAAAAAGTGG + Intergenic
921035188 1:211371017-211371039 TAGGTTGGAGAACCAAGCAGAGG + Intronic
923396017 1:233564795-233564817 TAGGCAGGAGTAACAAAGAGAGG + Intergenic
924409555 1:243789344-243789366 TAGGCTGGAGCAGAATACAGTGG - Intronic
924491893 1:244545984-244546006 TATGCAGCAGCACCAAAAAGTGG + Intronic
1068168383 10:53360484-53360506 TAGACTGAATCACCAAAATGTGG + Intergenic
1069397967 10:68010320-68010342 GAGCCTGGGGCACCAAAATGGGG + Intronic
1069779932 10:70948844-70948866 GGGGCTGGAGGTCCAAAAAGAGG + Intergenic
1070209045 10:74295608-74295630 AAGGGAGGAACACCAAAAAGAGG - Intronic
1071425781 10:85547979-85548001 TTCTCTGGAGGACCAAAAAGAGG + Intergenic
1071467368 10:85953655-85953677 TAGGCTGAAGCAGCAGAGAGGGG - Intronic
1074322431 10:112415712-112415734 TTGGCTGGAGGCCCAAAAATGGG + Intronic
1074480364 10:113814837-113814859 TAGGCTGGATAAAGAAAAAGTGG + Intergenic
1076672988 10:132133389-132133411 GAGACTGCAGCTCCAAAAAGAGG + Exonic
1078092553 11:8275988-8276010 TAGGATGGAGTCCCAGAAAGAGG - Intergenic
1080515647 11:33016893-33016915 CAGACTGGAGCTCCAGAAAGGGG - Intronic
1081502193 11:43677816-43677838 TAGACTGGATTAACAAAAAGTGG - Intronic
1084917990 11:72445207-72445229 TAGGCTGTAGCACCAAGAAAGGG - Intergenic
1087434802 11:98101186-98101208 TAGGATGTAGCAAAAAAAAGGGG + Intergenic
1090067968 11:123519412-123519434 TTGGCTGGAGGACTAGAAAGAGG + Intergenic
1092396730 12:8133880-8133902 TAGCCTGGGGTACCAAAATGGGG + Intronic
1093738022 12:22646386-22646408 TGGTCTGGAGCCCCAAGAAGAGG + Intronic
1097067300 12:56330146-56330168 TTGGATGCAGCACCAAAAAGGGG - Intronic
1099108993 12:78533089-78533111 GAGGCTGGAATACCAAATAGTGG - Intergenic
1100931875 12:99619063-99619085 CAGGCTGGAGCACCCAACAATGG - Intronic
1102732757 12:115127445-115127467 TAGGCTGGAGGAACAAGGAGGGG + Intergenic
1105544009 13:21338857-21338879 GAGGCTGGAGCAGGAAACAGAGG + Intergenic
1106783892 13:33087868-33087890 TGGGCTGGGGTACCACAAAGGGG + Intergenic
1108026104 13:46179716-46179738 TGGTCTGGTGCACCAAAATGTGG + Intronic
1110560957 13:76910390-76910412 TAGGCAGGAGCAGAAAAAAATGG - Intergenic
1110694783 13:78475245-78475267 TTGGCAGGAGCACCTACAAGTGG + Intergenic
1111470127 13:88670090-88670112 TAAGCTGGAGCACCTACATGTGG + Intergenic
1111651982 13:91103228-91103250 CAGGCTGGAGCATCAGGAAGAGG + Intergenic
1112586339 13:100722053-100722075 GAGGCTGGAGGACCAAGTAGGGG + Intergenic
1115510501 14:34133114-34133136 GAGGCTGGAGGACGGAAAAGAGG + Intronic
1118141619 14:63090214-63090236 TGGACTGGAGCAGCAAGAAGGGG - Intronic
1118821555 14:69349361-69349383 TAGGCTGGGTCAGCACAAAGGGG - Intronic
1121500972 14:94437211-94437233 TGGGCTGGAGAAACAAAAATTGG + Intergenic
1122271705 14:100571187-100571209 TGGGCTGGACCACCAGAAAGAGG - Intronic
1122776525 14:104119295-104119317 CAGGCTGGAGCCCCTGAAAGTGG - Intergenic
1123829513 15:24120077-24120099 TAGCCTGGAGCACCTAGTAGTGG - Intergenic
1123844418 15:24283473-24283495 TAGCCTGGAGCACCTAGTAGTGG - Intergenic
1123859516 15:24449742-24449764 TAGCCTGGAGCACCTAGTAGTGG - Intergenic
1126788632 15:52199899-52199921 CTAGCTGAAGCACCAAAAAGGGG + Intronic
1129456556 15:75679103-75679125 TAGGCTGGAGCTACAAATAAGGG - Intronic
1133933583 16:10251618-10251640 TAGACAGAAGCACCAAAAAGGGG + Intergenic
1134830120 16:17316147-17316169 TAGGCTGTGGAACCAAACAGTGG + Intronic
1135119442 16:19753006-19753028 TAGGCTGGTGCCACAAAATGAGG - Intronic
1135208243 16:20500281-20500303 TTGGCTGGAACACCTACAAGAGG + Intergenic
1135210656 16:20523419-20523441 TTGGCTGGAACACCTACAAGAGG - Intergenic
1141965775 16:87442029-87442051 CTGGCTGGAGGACCAAAAAGGGG + Intronic
1142466429 17:140032-140054 GAGGCGGGAGCCCCAGAAAGAGG + Intergenic
1142965560 17:3578792-3578814 TAGACTGGATAATCAAAAAGTGG + Intronic
1144413523 17:15023904-15023926 TATGCAGGGGCACCCAAAAGGGG - Intergenic
1147522544 17:41188322-41188344 TATGCTGGACCAGCAAACAGAGG + Intergenic
1148180890 17:45603889-45603911 TGGGATGGAACACAAAAAAGTGG + Intergenic
1148268015 17:46242027-46242049 TGGGATGGAACACAAAAAAGTGG - Intergenic
1149505339 17:57189477-57189499 TAGGCTGGAACTCCCAGAAGTGG - Intergenic
1149756613 17:59191574-59191596 GAGGCTGGAGAAACAAAAGGTGG - Intronic
1157519784 18:48337411-48337433 TAGGCTGGAGACCCCAAAGGTGG - Intronic
1157710575 18:49847179-49847201 CATGCTGGAGTACCACAAAGAGG - Exonic
1158928574 18:62297338-62297360 ATGACTGGAGCACCAAAATGTGG - Intronic
1162492527 19:11002161-11002183 TAGGCTGGAGCACAGAAGAATGG + Intronic
1162747886 19:12809331-12809353 TTGGCTGCAGCACCGAAGAGAGG - Intronic
1164362245 19:27526660-27526682 TTGGCAGGATCTCCAAAAAGAGG - Intergenic
1164534531 19:29075447-29075469 GAGGCTGCAGCACCAAGGAGAGG - Intergenic
1166576709 19:43847581-43847603 AAGGCTTGAGCCCCAAAAAAAGG - Exonic
1167803599 19:51763089-51763111 CAGACTGGAGCACCAGAGAGAGG + Exonic
925094755 2:1187463-1187485 CAGGCTGGAGCCCCAGGAAGTGG - Intronic
925433104 2:3814142-3814164 TTGACTGGAGTACCAAAAGGAGG - Intronic
929279125 2:40059149-40059171 TAGGCTGGAAAAACAAAATGTGG + Intergenic
930325238 2:49908267-49908289 GAGGCTGGAGTATTAAAAAGGGG - Intergenic
934619049 2:95793060-95793082 TAGGCTGGCTCAGGAAAAAGGGG - Intergenic
934641842 2:96031497-96031519 TAGGCTGGCTCAGGAAAAAGGGG + Intronic
937030839 2:118738922-118738944 AAGGCTGGAGCACCAAATGGGGG + Intergenic
939051028 2:137308124-137308146 TGGGCAGGAGCATCAAGAAGGGG - Intronic
939432921 2:142133637-142133659 TAGGCTGGAGCACCAATAAAAGG + Intergenic
940595338 2:155784325-155784347 TAGGCTGGATAACGAAAATGTGG + Intergenic
940606417 2:155928859-155928881 TACCCTGGAGCACCAATAAGTGG + Intergenic
940799996 2:158122973-158122995 GAGGAAAGAGCACCAAAAAGGGG + Intronic
943336880 2:186626180-186626202 TCCTCTGGATCACCAAAAAGGGG - Intronic
944444110 2:199772629-199772651 TAGACTGGATGACCAAGAAGGGG - Intronic
944673518 2:202016059-202016081 TAGGATGGAGCGCCCAAATGGGG - Intergenic
945156058 2:206839176-206839198 TAGGCTGGATAAACAAAATGTGG - Intergenic
1170169061 20:13391374-13391396 TAAGCCAGATCACCAAAAAGAGG - Intronic
1177021146 21:15859824-15859846 TTGGATGGAAGACCAAAAAGGGG - Intronic
1179643643 21:42762399-42762421 CAGAGTGGAGCCCCAAAAAGAGG + Intronic
949325813 3:2862997-2863019 TAGGCTGGAGCACCAAAAAGGGG - Intronic
949693357 3:6666315-6666337 TAGGTCTGAGCAACAAAAAGAGG - Intergenic
950010689 3:9721562-9721584 TAGGCTCCAGTACCATAAAGGGG + Intronic
952826630 3:37530087-37530109 CAGGCTGGAGCCCCTAAGAGAGG + Intronic
953355157 3:42249698-42249720 TGGGGTGGAGGATCAAAAAGGGG + Intergenic
954459115 3:50616601-50616623 TAAGCGGGAGCTGCAAAAAGGGG + Intronic
958554053 3:95650835-95650857 TAGACTGGAGCAAGAAAACGTGG + Intergenic
959285389 3:104401988-104402010 TAGACTGGAGAAACAAAATGTGG + Intergenic
961223391 3:125217819-125217841 TTGGCTGGAACACCAACATGTGG - Intergenic
961529535 3:127532102-127532124 GAGGCTGGAGCACAAAATAATGG + Intergenic
961746119 3:129064432-129064454 TAGGTTGTAGCAGCAAAAACTGG - Intergenic
964148912 3:153500216-153500238 TAGGGTTGAGACCCAAAAAGAGG - Intronic
964780184 3:160328752-160328774 CAGGCTGGAGAACGAAAATGTGG + Intronic
965344382 3:167529789-167529811 TAGGCTCATTCACCAAAAAGGGG - Intronic
965567765 3:170138798-170138820 TAGGCTGGAGGACTAGAAACTGG - Intronic
966081718 3:176012687-176012709 TAGACTGGATCAAGAAAAAGTGG + Intergenic
970441679 4:16085440-16085462 TAGGCTGGAGCTAGCAAAAGAGG + Intergenic
971764000 4:30805702-30805724 TAGGTTGGAACAGCATAAAGAGG - Intronic
979886679 4:126035705-126035727 TAGGCTGGATCAAGAAAACGTGG + Intergenic
981520999 4:145662219-145662241 TAGGCTGAAGGAGGAAAAAGAGG - Intergenic
981737307 4:147966467-147966489 TAGACTAGAGCACCAAAGAGAGG + Intronic
982302417 4:153893114-153893136 TAGGCTGGGGCAATAAATAGAGG + Intergenic
983474262 4:168195529-168195551 CAGGCTGGGGCACCAAGAAATGG - Intergenic
985839196 5:2293294-2293316 TAGGCTGGAGAAAGAAAATGTGG + Intergenic
992131153 5:73694174-73694196 TAGGAGGGGGCACCATAAAGTGG - Intronic
992448094 5:76851587-76851609 TTGACTGGAGCAGCAAAAAAAGG + Intronic
993467256 5:88264704-88264726 TAGACTGGATCACAAAAATGTGG + Intronic
993721902 5:91329892-91329914 AAAGCTGAAGCACCACAAAGTGG - Intergenic
993899139 5:93572570-93572592 AGGGCTGGGGCACCAGAAAGAGG - Intergenic
995612397 5:113924089-113924111 AAGGCTGCAGCCCCAATAAGGGG + Intergenic
999984515 5:156990504-156990526 TAGACTGGATCAACAAAATGTGG + Intergenic
1000408566 5:160914965-160914987 AAGGCTGGAGCAGCACAAGGTGG + Intergenic
1002006307 5:176237969-176237991 TGGGCGTGTGCACCAAAAAGTGG + Intergenic
1002220068 5:177672667-177672689 TGGGCGTGTGCACCAAAAAGTGG - Intergenic
1003514528 6:6806934-6806956 TAGGCGGAAGCTCCAGAAAGCGG + Intergenic
1004077033 6:12353089-12353111 TAGGCTGGATAACAAAAATGTGG - Intergenic
1004461020 6:15836105-15836127 TAGATTAGACCACCAAAAAGGGG - Intergenic
1006028875 6:31164710-31164732 TAGCCTGGGGTACCAAAATGGGG + Exonic
1006728889 6:36220194-36220216 TAGGATGCAACACCAAAAATAGG - Intronic
1008456428 6:51716441-51716463 TAGGCAGAGGCACCAAGAAGGGG + Intronic
1009993776 6:70876996-70877018 TAGGCTGGAGCAGCAATGATGGG + Intronic
1010935486 6:81855850-81855872 TAGGCTAGAGTAGCAAGAAGAGG + Intergenic
1012229552 6:96745037-96745059 TAGGGTGGAATACCAAAGAGGGG + Intergenic
1019402822 7:866331-866353 ATGGCTGGAACACCCAAAAGAGG - Intronic
1021709878 7:23405512-23405534 TAGGCTGGAGAAGCAAGAAAGGG + Intronic
1023712732 7:43012116-43012138 TAGGCTGGATAACAAAAATGTGG - Intergenic
1024211741 7:47212190-47212212 GAGGCTGGAGAAGCAAAAATTGG - Intergenic
1024244362 7:47457987-47458009 TAGTCTGAGGCACCAAAAAAAGG + Intronic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1029042744 7:97594813-97594835 TTGGCTGGAGCAGAAAGAAGAGG - Intergenic
1035104211 7:156428682-156428704 AAGGCAGGAGCACCAGGAAGGGG + Intergenic
1035104282 7:156429074-156429096 AAGGCAGGAGCACCAGGAAGGGG + Intergenic
1035104325 7:156429298-156429320 AAGGCAGGAGCACCAGGAAGGGG + Intergenic
1035888270 8:3316753-3316775 TCGGCTGCAGCACCAAGGAGTGG + Intronic
1036550285 8:9809661-9809683 TAGGCTCGAAAACAAAAAAGGGG + Intergenic
1037765293 8:21768818-21768840 TGGGCTGGAGCACCCCAGAGAGG + Intronic
1038112787 8:24517937-24517959 CAGGCTGCAGCACAAAGAAGGGG - Intronic
1039607333 8:38892372-38892394 TAGCCTGGAGGACCATAGAGAGG - Intergenic
1046755608 8:117970163-117970185 TATACTGGAGCACTATAAAGAGG + Intronic
1047697407 8:127416815-127416837 TAGCCTGGGGTACCAAAATGGGG - Exonic
1048474135 8:134727978-134728000 GAGACAGGAGCACCCAAAAGTGG - Intergenic
1049469109 8:142767474-142767496 GAGGCTGGGGCACCAGAAGGAGG + Intronic
1050331325 9:4549331-4549353 TAGGATGGAGGAGCAAAGAGCGG - Intronic
1056751738 9:89356935-89356957 AAGGCTGGTGCACCAGAGAGAGG - Intronic
1058396828 9:104563553-104563575 TAGGTTAGAGCACCAGACAGCGG - Intergenic
1058983540 9:110191837-110191859 GAGGCTAGAGAAACAAAAAGAGG + Intronic
1059930078 9:119251692-119251714 TAGGGGGGAGCATGAAAAAGAGG + Intronic
1060773177 9:126347340-126347362 GAGGCAGGAGCAGCAAAAAAGGG - Intronic
1062137416 9:134937007-134937029 TAGCCTGGAACACTTAAAAGAGG - Intergenic
1186226189 X:7401351-7401373 CAGGCTGAAGAACCAAAAACAGG - Intergenic
1188001501 X:24986844-24986866 TAGTGTGGAGCACCTAAGAGTGG - Intronic
1190039079 X:47054550-47054572 TGGGCTGGTGCAGCCAAAAGAGG + Exonic
1191162649 X:57348058-57348080 CAGCCTGGAGCACCTAAAATAGG - Intronic
1192959265 X:76110129-76110151 TAGGATAGAGCACCAAGAGGTGG + Intergenic
1197264286 X:124349357-124349379 TACAGTGTAGCACCAAAAAGAGG - Intronic
1198098378 X:133402568-133402590 AAGGCTGATGCAACAAAAAGGGG + Intronic
1199555209 X:149100414-149100436 TTGGCTGAAGCACTGAAAAGTGG + Intergenic
1201895199 Y:18985437-18985459 TGGGTTGGAGGACAAAAAAGGGG - Intergenic