ID: 949328883

View in Genome Browser
Species Human (GRCh38)
Location 3:2899164-2899186
Sequence AAGGGCCTAGAGACCTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949328883 Original CRISPR AAGGGCCTAGAGACCTCTGC TGG Intronic
900544666 1:3222036-3222058 CGGGGCCTGCAGACCTCTGCTGG - Intronic
902569756 1:17339636-17339658 CAGGGCCCTGAGACCGCTGCTGG - Intronic
902727451 1:18346702-18346724 CAGGGCCTATGGACCTCTACAGG + Intronic
903230294 1:21918115-21918137 AAGGGTCTGGACTCCTCTGCTGG - Intronic
908470295 1:64437515-64437537 AGGGGCTTTGAGTCCTCTGCTGG - Intergenic
909760236 1:79277273-79277295 AAGGGAAGAGACACCTCTGCAGG - Intergenic
913596546 1:120384471-120384493 AAGGGCCTTAAGCCCTCTGGGGG + Intergenic
914307884 1:146439704-146439726 AAGGGCCTTAAGCCCTCTGGGGG + Intergenic
914594225 1:149133429-149133451 AAGGGCCTTAAGCCCTCTGGGGG - Intergenic
920182938 1:204143632-204143654 AAGGGGCTGGAGGTCTCTGCAGG + Intronic
921527382 1:216234575-216234597 AAGGGCCTAGATACCTTCACAGG - Intronic
922882084 1:228988791-228988813 GAGGGCCTGGTGACCTCGGCTGG + Intergenic
923348485 1:233080633-233080655 AAGGGGCTAGAGAGCTCTCTGGG + Intronic
924351849 1:243122187-243122209 AAGGGCCTGGTGACCTCTTCGGG + Intergenic
1063641551 10:7835713-7835735 AAGGGCCACCAGGCCTCTGCTGG - Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1071514660 10:86289290-86289312 AAGGGCCTGGAGACCACTGCTGG + Intronic
1075246089 10:120823284-120823306 AGGGGCCCAGAGGCCTCTGCAGG - Intergenic
1075274038 10:121077545-121077567 CAGGGCCTAGACACCCCTGCTGG + Intergenic
1076791984 10:132781704-132781726 AAGGGCCGAGCTGCCTCTGCTGG + Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1079079071 11:17401468-17401490 AGGGGCCTGGATACCTCTCCAGG + Intronic
1079750574 11:24191320-24191342 AAAGGCCTAGATACCTATGTAGG - Intergenic
1081553255 11:44133531-44133553 AAGTGGATGGAGACCTCTGCTGG - Intronic
1081709106 11:45205597-45205619 ATGGGCCTGGGGCCCTCTGCCGG + Intronic
1081810889 11:45913638-45913660 GATGGCCCAGAGAGCTCTGCGGG + Intronic
1082317984 11:50753521-50753543 AAGCGCTTAGAGACCTATGGTGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084499918 11:69529413-69529435 AAGGTCCTGGAGTCCTCTCCTGG - Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1086017926 11:82189778-82189800 CAGGGCCTAGAGCTTTCTGCTGG - Intergenic
1086930659 11:92689521-92689543 AATAGCCTAGAGACTTCTTCAGG + Intronic
1088802551 11:113319656-113319678 AAGAGCCAAGAAAACTCTGCAGG + Intronic
1091748525 12:3008428-3008450 AACGGCCTGGAAACCCCTGCAGG - Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092428676 12:8392701-8392723 AAGGAACTAGAGACTTGTGCAGG + Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1096803779 12:54127908-54127930 CAGGGCCAAGTGGCCTCTGCAGG - Intergenic
1097104820 12:56615817-56615839 AGGGGGCTAGAGAGCTCTCCAGG + Intronic
1098123909 12:67270002-67270024 CGGGGCCTAGAGACCGCGGCGGG - Intronic
1101079989 12:101172489-101172511 AAGGGCAGAGTGACCTCTACTGG - Intronic
1102227743 12:111240874-111240896 CAGGGTCTAGAAAGCTCTGCAGG + Intronic
1103977181 12:124710701-124710723 AAGGGCTTAGAGAGCTCTCTGGG + Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1113377946 13:109782317-109782339 ATGCGCAGAGAGACCTCTGCCGG - Exonic
1115680178 14:35729991-35730013 AAGGACCCACAGACCTCTGAAGG + Intronic
1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG + Intergenic
1121341275 14:93106533-93106555 AGGGGCCTAGAGCTCTCTCCAGG - Intronic
1121633363 14:95437426-95437448 AGGGGCCAAGACACATCTGCAGG - Intronic
1121785932 14:96661048-96661070 AGGGGCCTGGAGGCCCCTGCAGG - Intergenic
1122279335 14:100611955-100611977 GAGGGCCTAGACACCTCTGGGGG - Intergenic
1122843817 14:104479846-104479868 AGGTGCCTCGTGACCTCTGCAGG - Intronic
1122852396 14:104543672-104543694 AAGGGGCGAGTGGCCTCTGCTGG - Intronic
1202924472 14_KI270724v1_random:11150-11172 AATGGCCAAGTGTCCTCTGCAGG - Intergenic
1124877933 15:33613101-33613123 AAAGGCTCAGAGGCCTCTGCGGG - Intronic
1125932649 15:43611450-43611472 AAGAGGATAGAGACCTCTGGCGG + Intronic
1125945747 15:43710912-43710934 AAGAGGATAGAGACCTCTGGCGG + Intergenic
1129787859 15:78321187-78321209 AACGGCCCTGAGACCACTGCAGG - Intergenic
1133225464 16:4338431-4338453 AAGGACCCAAAGGCCTCTGCAGG - Exonic
1136448111 16:30336197-30336219 CAGGGACTAGTGGCCTCTGCTGG - Intergenic
1138598018 16:58039813-58039835 AAGGGCCTACTATCCTCTGCTGG - Intronic
1139914652 16:70420561-70420583 AAGGGCCTGCAGACGTCTGCTGG + Intronic
1141628154 16:85272314-85272336 AAAGGCCCCGACACCTCTGCGGG - Intergenic
1146177193 17:30673397-30673419 AAGTGCCCAGAGACCCCGGCAGG - Intergenic
1151470094 17:74312589-74312611 ATGGGCCTTGAGACCCCTGGAGG + Intronic
1152895317 17:82907581-82907603 TGGGTCCCAGAGACCTCTGCAGG - Intronic
1157699866 18:49755379-49755401 AAGGGCCCTGAGAGCTGTGCTGG + Intergenic
1163447979 19:17358710-17358732 AAGGGACTAGGGGCCTCTGTAGG - Intronic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164447613 19:28331350-28331372 CAGGGTCTAGGGACCTCTGCTGG + Intergenic
1164567850 19:29340770-29340792 AATGGCTTAGAAACCTATGCAGG - Intergenic
1165448000 19:35867279-35867301 AAGAGCCTAGAGTGCTTTGCAGG - Intronic
1165921030 19:39298012-39298034 AAGGTCCTGGAGGCCGCTGCTGG + Exonic
925605244 2:5653833-5653855 AAGGGCCTTAAGCCCTCTGGGGG + Intergenic
926619208 2:15031892-15031914 AAAGCCCAAGAGACCTCAGCTGG + Intergenic
927056429 2:19369702-19369724 CTGGGCCAAGTGACCTCTGCTGG - Intergenic
928935968 2:36678271-36678293 GAGGGCATGGTGACCTCTGCAGG + Intergenic
932048610 2:68376484-68376506 ATGATCCTATAGACCTCTGCAGG - Intronic
932275800 2:70451367-70451389 AAGGACCTAGAGACATGTCCAGG - Intronic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
934712475 2:96525067-96525089 AAGGTCCAAGAGCCCTCTGGAGG - Intergenic
936098778 2:109556042-109556064 AAATGTCTAGAGAGCTCTGCTGG - Intronic
937089856 2:119198943-119198965 AAGAGCCTACAGACCCCTGATGG + Intergenic
940280841 2:151988310-151988332 TAGGGCCTAGAGAGCTCAGTGGG - Intronic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
942603974 2:177671176-177671198 CAGGGGCTACAGACCTATGCAGG - Intronic
943307031 2:186275702-186275724 AAGGGGCAAGAGAGCTCTTCAGG + Intergenic
947004430 2:225494310-225494332 AATAGCCTTGATACCTCTGCAGG + Intronic
947098266 2:226591491-226591513 AGGTGGCTGGAGACCTCTGCTGG + Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947633024 2:231665948-231665970 ACGAGCCCACAGACCTCTGCAGG - Intergenic
1169552979 20:6720276-6720298 AAGGGGCAAGAGACCCCTCCAGG + Intergenic
1170679622 20:18514393-18514415 ATGGGGCTAGAGTCTTCTGCTGG + Intronic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1174329228 20:49804623-49804645 AAGGGACAAGAGACCCCTTCAGG + Intergenic
1175620108 20:60436477-60436499 AAAGGCTTAGAGACTTCTCCAGG - Intergenic
1175736692 20:61392090-61392112 AAAGGCCTAGAGAGCTTTGCAGG + Intronic
1178819048 21:35958683-35958705 AAGGGCATTGTGACCTCTGTGGG - Intronic
1179486181 21:41712222-41712244 AAGGGGCCGGAGACCTCGGCAGG + Intergenic
1185155425 22:49190907-49190929 AAGGGAAAAGAGACCTCTCCAGG + Intergenic
949328883 3:2899164-2899186 AAGGGCCTAGAGACCTCTGCTGG + Intronic
954294877 3:49668704-49668726 AAAGGCCCAGAGCCCTGTGCGGG + Exonic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
957115945 3:76026896-76026918 AAGGTCCTTGAGACCTCTCGAGG - Intronic
957944632 3:87047676-87047698 AAGGGCCAAGAAGCCTATGCAGG - Intergenic
958925206 3:100149896-100149918 AGGCCCCAAGAGACCTCTGCAGG - Intronic
960589751 3:119354029-119354051 GAGGACCTGGACACCTCTGCAGG + Intronic
960598727 3:119433650-119433672 AATGGCCTAGAGAATTCAGCTGG + Intronic
961024369 3:123540325-123540347 GAGGGCCCAGAGACCTCTTAAGG + Intronic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
964253855 3:154751267-154751289 AAGGCACTAGAGACCAATGCTGG + Intergenic
965733605 3:171798276-171798298 AAGGGTCTAGAGACCTTTCTAGG + Intronic
969489300 4:7490153-7490175 AAGGGCCCAGGGGCCTCTCCCGG + Intronic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970877602 4:20890307-20890329 TGGGGCCTAGAGACTTCTGTTGG + Intronic
971458063 4:26862013-26862035 AAGGGTGTAGAAACCTCAGCAGG + Intronic
979250088 4:118558348-118558370 AAGGGCCTGGTGGCCTCTTCGGG - Intergenic
980849662 4:138365669-138365691 TAGGGCATAGAGACATTTGCCGG - Intergenic
985009072 4:185563858-185563880 CAGGGCCAAGAGAACTCTGGAGG - Intergenic
987828979 5:23071734-23071756 AAGGTTATAGAGACTTCTGCTGG + Intergenic
989482850 5:41952012-41952034 GAGGACCTAGAGGCTTCTGCTGG - Intergenic
991361546 5:65826192-65826214 AAGGGTTTAGAAACTTCTGCAGG + Exonic
993495858 5:88608171-88608193 AAGGGGCAAGAGAGCTCTCCGGG - Intergenic
993618298 5:90138441-90138463 AGGGGCCTATAGAGCTCTGAGGG - Intergenic
996036344 5:118762800-118762822 AAGTGCCTGGAGACCTCTGTTGG - Intergenic
998169417 5:139863862-139863884 AGGGGCATAGAGACCCCTGGGGG - Intronic
1000441592 5:161270348-161270370 AATGGCCTAGAGAGTTCTGAAGG - Intergenic
1001522876 5:172407438-172407460 AAGACCCCAGTGACCTCTGCTGG + Intronic
1001640481 5:173240366-173240388 AAGGGCCTAGAGCCCACAGAAGG + Intergenic
1004422484 6:15484097-15484119 AAGGACCTAGAAACCCTTGCAGG - Intronic
1009715664 6:67391558-67391580 AAGGGCCTTCTGTCCTCTGCAGG + Intergenic
1009968638 6:70603946-70603968 AAGGACCCACAGACCTCTGAAGG + Intergenic
1010751564 6:79621382-79621404 AAGGGGCTAGATAGCTCTCCAGG - Intergenic
1013993211 6:116278536-116278558 AAGGGCCTGGGGATCTCTACAGG + Exonic
1017045580 6:150344440-150344462 AAGGACATGCAGACCTCTGCTGG + Intergenic
1017530989 6:155292094-155292116 AAGGGCCTCCAGTCCTCTTCAGG - Intronic
1017684515 6:156898519-156898541 AAGGCCCCAGAGCCTTCTGCTGG - Intronic
1019305887 7:335592-335614 CAGGGCCTGGGGACCTCTGGAGG - Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1021963071 7:25891842-25891864 AAGAGCCTGGAGTGCTCTGCAGG - Intergenic
1021981702 7:26061852-26061874 TAGAGCCTAGAGCCCCCTGCTGG + Intergenic
1023041707 7:36178471-36178493 AAGGGCTTAGAGACAGCTGGAGG - Intronic
1026610959 7:71859468-71859490 AAGTTCCTAGAGGCCTCTGACGG - Intronic
1026988665 7:74570816-74570838 AAGGGACAAGAGAGCCCTGCCGG + Intronic
1028780167 7:94727169-94727191 AAGGGTCCAGAGACCACTGTTGG + Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1029870036 7:103680868-103680890 CAGGGCCTATTGACCTCTGCAGG - Intronic
1032325889 7:130927821-130927843 AAAGGGGTTGAGACCTCTGCTGG - Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039451909 8:37681879-37681901 AGGGCCCTGGAGACCTCTGCTGG + Intergenic
1040088998 8:43376825-43376847 ATGGGCCTTGAGCCCTCTGAAGG + Intergenic
1042965295 8:74344877-74344899 AAAAGCCTAGAGACCTCTTGTGG + Intronic
1044088838 8:87974255-87974277 GAGTGCCTAGACTCCTCTGCCGG + Intergenic
1047681661 8:127259777-127259799 ATGGGCCAAGGGACCTGTGCAGG - Intergenic
1049396486 8:142403316-142403338 CTGGGCCAAGAGGCCTCTGCGGG + Intergenic
1052142420 9:25003879-25003901 AGGGGACTAGAGCCCCCTGCTGG + Intergenic
1053937962 9:43188030-43188052 AAGTGCCTTGAGGCCTATGCTGG + Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1060759304 9:126234669-126234691 AAGGACCTGGAGACCACAGCTGG - Intergenic
1060765417 9:126292102-126292124 AAGGACTTAGAGACCTCAGTAGG - Intergenic
1061268634 9:129523377-129523399 GAGGGCCAAGGGGCCTCTGCCGG - Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1185795498 X:2961058-2961080 AAAGGCCTAGAGGACTCTGCAGG + Intronic
1187406473 X:19009061-19009083 AATTGCCTAGAACCCTCTGCTGG + Intronic
1188983822 X:36751941-36751963 AAGGGCCAAGAGAGATCTCCAGG - Intergenic
1197023135 X:121715887-121715909 AGGTGCCTGGAGACCCCTGCAGG + Intergenic
1199968952 X:152844493-152844515 AAGGCCTTATTGACCTCTGCTGG - Intronic
1200948291 Y:8867426-8867448 AAGGGCCTATAGAACTCTGGGGG + Intergenic