ID: 949329094

View in Genome Browser
Species Human (GRCh38)
Location 3:2901480-2901502
Sequence ATGGAGAAGGTGCATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 402}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949329094 Original CRISPR ATGGAGAAGGTGCATGAGGC AGG (reversed) Intronic
900735781 1:4298634-4298656 ATGGAGTGGGTGAATGAGGAGGG + Intergenic
900898602 1:5501813-5501835 AAGGAGAGGGTTCATGTGGCTGG - Intergenic
901142372 1:7043451-7043473 AAGGAGATGGTGCATGATGTCGG + Intronic
901921670 1:12541467-12541489 TTGGAGGAGGTGCAGGGGGCCGG + Intergenic
902729202 1:18357462-18357484 ATGGAGATGGGGGATGAGGTGGG + Intronic
903557345 1:24203291-24203313 AAGGAGATGGTGGCTGAGGCAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904363466 1:29993752-29993774 AGGGGGCAGGTGCATGAGCCGGG - Intergenic
904366165 1:30012142-30012164 ATGGAGAGGGTGCCTGGGGGCGG - Intergenic
904494545 1:30879238-30879260 CTGGAGCAGGTGGTTGAGGCTGG - Intronic
905227152 1:36486782-36486804 ATGGAGGAGGGGCGGGAGGCAGG - Intergenic
905529014 1:38661731-38661753 TTTGAGAAGGTGCATTAGTCTGG + Intergenic
905858378 1:41330048-41330070 CTGGAGAAGGGGCCTGGGGCTGG - Intergenic
905975258 1:42169565-42169587 ATGGCAAAGGTGTAGGAGGCTGG - Intergenic
906527879 1:46506963-46506985 AGGGAGAGGGGCCATGAGGCAGG - Intergenic
907412010 1:54289790-54289812 CTGGAGATGGTGCAGGGGGCGGG - Intronic
908518218 1:64915104-64915126 ATTGTGAAGGTAAATGAGGCAGG + Intronic
910771384 1:90835764-90835786 TAGGAGAAGGTGCCTGAGGGAGG + Intergenic
912459996 1:109824116-109824138 TTGGAGAGGGTGCAGGAGCCGGG - Intergenic
912731693 1:112112621-112112643 TTGGAGAAGATGCAAGTGGCTGG - Intergenic
915465124 1:156092844-156092866 AAGGAGAAAGTCCATGTGGCTGG - Intronic
915472896 1:156136380-156136402 GTGGAGGAGGTGGATGAGGAGGG + Exonic
915650124 1:157303567-157303589 AGGGAGAAGGTGCATGAAGATGG + Intergenic
917387267 1:174491044-174491066 AGGGAGATAGAGCATGAGGCAGG - Intronic
918287480 1:183071811-183071833 AGGGAGAAGGTGCATGTGATGGG + Intronic
918339140 1:183552880-183552902 ATGGAGATGGGGCAGGAGGGTGG - Intronic
918660435 1:187081548-187081570 TTGGAGAAAGTCCATGGGGCTGG + Intergenic
919710429 1:200722018-200722040 AAGGAGAAGGTGAAATAGGCTGG + Intergenic
919811088 1:201409200-201409222 TTGGAGAAGAAGCATGAAGCAGG + Exonic
920308542 1:205034274-205034296 ATGGAGAGGGAGCATGAGCCAGG - Intergenic
921165281 1:212502508-212502530 ATGGAGGAGATGGCTGAGGCAGG + Intergenic
921369685 1:214408706-214408728 ATGGTGAGGGTGTATGAGACAGG + Intronic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921879776 1:220243017-220243039 ATGTTGAAGGTGCATGTGGAAGG - Intronic
922757542 1:228105005-228105027 ATGGAGCAGGTGCATGGCGAGGG + Intronic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
924289526 1:242524028-242524050 ACGGGGAGGGTGCATGCGGCAGG + Intronic
924552564 1:245092024-245092046 CTGGGGAAGGTGCATGACTCAGG + Intronic
1063789028 10:9419910-9419932 AAGGAGAAATTACATGAGGCTGG + Intergenic
1063982896 10:11470228-11470250 ATGGAGAAGGTGGAGGATGGAGG + Intronic
1064685300 10:17855273-17855295 ATGAAGACGCTGCATGCGGCCGG + Intronic
1065184260 10:23156894-23156916 AGGGAGAAGGAGCGGGAGGCAGG + Intergenic
1065623428 10:27606895-27606917 CTGCAGAAGGTGCAAGATGCTGG + Intergenic
1066984798 10:42455258-42455280 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067370495 10:45677909-45677931 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067389285 10:45848247-45848269 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067416785 10:46108711-46108733 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067440645 10:46307631-46307653 ATGGTGCAGGTGGGTGAGGCTGG + Intronic
1067444971 10:46336302-46336324 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067502184 10:46815594-46815616 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067592401 10:47524426-47524448 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067639517 10:48032499-48032521 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067873978 10:49987806-49987828 ATGGAGAAGGAGGTGGAGGCAGG + Intronic
1069595915 10:69670122-69670144 AGGGAGAAGGTTGATGAGGCAGG - Intergenic
1069775944 10:70927197-70927219 AGGAAGAAGATTCATGAGGCAGG + Intergenic
1069778780 10:70942002-70942024 ACTGAGGTGGTGCATGAGGCTGG + Intergenic
1069986981 10:72291171-72291193 CTGGGGGTGGTGCATGAGGCTGG + Intergenic
1070136502 10:73698649-73698671 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1071356190 10:84798653-84798675 ATTGAGAAAGGGCAGGAGGCAGG - Intergenic
1072018022 10:91369297-91369319 AGGGAGAATGTACATGAGTCTGG + Intergenic
1072426418 10:95334441-95334463 ATGGAGAAGGGGCTTGTGCCAGG + Intronic
1073353310 10:102835019-102835041 AGGGAGAGGGGGCATGAGGGTGG + Intronic
1074429596 10:113382607-113382629 AAGGAGAAGGTGGAGGAGGTAGG - Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076109410 10:127849448-127849470 ACGGACAAGGGGCATGAGGAGGG + Intergenic
1076180609 10:128404604-128404626 AAGGAGAAGGTGGAGGAGTCAGG + Intergenic
1076572259 10:131440661-131440683 ATGGGGTAGGTGCAGGCGGCTGG - Intergenic
1077408517 11:2393097-2393119 GAGGAGAAGGTGCCTGGGGCAGG - Intronic
1077518303 11:3015740-3015762 AGGGAGCAGGTGCAGAAGGCAGG + Intronic
1077809144 11:5619998-5620020 AAGCAGAAGTTGCATGAGTCAGG - Exonic
1078590733 11:12638450-12638472 ATTCAAAAGGTTCATGAGGCAGG - Intergenic
1079536445 11:21520748-21520770 AAGGAGCAGGTGCATGGGGAGGG - Intronic
1081611341 11:44565258-44565280 AAGGAGAAAGTGAAGGAGGCGGG + Intronic
1083588549 11:63878254-63878276 ATGGAGATGAGGAATGAGGCTGG - Intronic
1084050057 11:66593505-66593527 ATGAAGAAGGTGCTTGAAGAGGG + Intronic
1084443332 11:69188671-69188693 ATGGAGAAGGGGCACGAGCCAGG + Intergenic
1085519097 11:77127782-77127804 AGGGAGAAGGCGCAGAAGGCAGG + Intergenic
1085742933 11:79092360-79092382 CTGGGAAAGGTGCATGAGGAGGG - Intronic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1089460879 11:118652771-118652793 AGGGAGAAGGGGCAGGAGACAGG + Intronic
1089733022 11:120531362-120531384 ATGGAGCAGGTGCCTGTGGCAGG - Intronic
1091857668 12:3752713-3752735 ATGAAGAGGCTGGATGAGGCTGG + Intronic
1091947596 12:4562238-4562260 CGGGAGGAGCTGCATGAGGCCGG - Intronic
1092140248 12:6178816-6178838 ATGGAGAAGCGTCATGGGGCAGG + Intergenic
1092266318 12:6983469-6983491 ATGGAAGAGGTGGATGAGGTAGG + Exonic
1092965215 12:13634737-13634759 TTGGGGAAGGTGTGTGAGGCTGG + Intronic
1095950385 12:47778481-47778503 GTGGAGGAGGAGCATGGGGCAGG + Intronic
1096197377 12:49657331-49657353 AGGGACAGGGTGCAGGAGGCAGG + Intronic
1096509977 12:52122263-52122285 AAGGTGAAGGTGAAGGAGGCTGG + Intergenic
1096866289 12:54565579-54565601 ATGGAGATGGTGCAGCAGGAAGG + Intronic
1100068358 12:90679673-90679695 ATGGAAATGGTGCATGTTGCAGG - Intergenic
1100478937 12:94959490-94959512 CTGGAGAAGGTGACTGAGACAGG - Intronic
1101714845 12:107301749-107301771 GTGGAGATGGGGCATGAGGTAGG - Intergenic
1102468821 12:113147632-113147654 ATGTAGAAGTTGCCAGAGGCTGG + Intergenic
1103221882 12:119253093-119253115 ATGGAGAAGGTCCAGGGTGCTGG - Intergenic
1104107381 12:125675858-125675880 TTTGAGAAGGTGCAGGAGGATGG + Intergenic
1104998603 12:132674500-132674522 GTAGAGAAGGGGCTTGAGGCAGG - Intronic
1105494885 13:20921821-20921843 ATGGAGGAGGTGCTTGGGTCTGG + Intergenic
1106438076 13:29741400-29741422 ATGGGGTAGGTGCATGGGGTAGG - Intergenic
1106545812 13:30730547-30730569 AGGGAGAAGGAGCAGGAGGTGGG - Intronic
1106825969 13:33520771-33520793 AGGAAGAAGTTACATGAGGCAGG + Intergenic
1108754647 13:53485207-53485229 CTGGAGCAGGAGCAAGAGGCAGG - Intergenic
1109142023 13:58725296-58725318 ATGGAGAAGGAGCTGGTGGCAGG + Intergenic
1109771339 13:66977566-66977588 ATAGAGAAGCTGCATGATTCTGG - Intronic
1110738353 13:78964917-78964939 ATGGCAAAGGTGGAAGAGGCAGG + Intergenic
1111746332 13:92274393-92274415 ATGGAGAGGGTAGATGATGCTGG - Intronic
1113711578 13:112468751-112468773 ATAGAGAAGGTCCCTGAGGTCGG + Intergenic
1116253432 14:42517483-42517505 AGGCAGAAGGTGCAAGAGGAAGG + Intergenic
1116427427 14:44807885-44807907 TTGGAGAAGGTCAATGAGGGTGG + Intergenic
1117465176 14:55986148-55986170 GTGGAGAAGGTGCAGGAGCCAGG + Intergenic
1117480636 14:56140882-56140904 ATGGGAAAGATGCATGAAGCTGG + Intronic
1117642014 14:57810131-57810153 ATGGAGGAGGGGCATGTGACAGG - Intronic
1117872474 14:60215740-60215762 ATGGAGAATGTGAATGAGGTTGG - Intergenic
1118604333 14:67491910-67491932 ATGGGGAAGGTGCATGGAGATGG + Intronic
1118706853 14:68488041-68488063 GTGGGGAGGGTGCATGAGACAGG + Intronic
1118720508 14:68590541-68590563 ATGGCAAAGGTGCCTGGGGCTGG + Intronic
1119110668 14:71970950-71970972 AGAGAGAAGGTGTAGGAGGCAGG + Intronic
1119523149 14:75301272-75301294 GTGGAGATGGTAAATGAGGCTGG + Intergenic
1120851896 14:89179340-89179362 GTGGAGAAGCTGCACGCGGCAGG + Intronic
1121631685 14:95425670-95425692 ATGGGGAAGATGGAGGAGGCTGG + Intronic
1121897845 14:97664975-97664997 ATAGAGAAGGTTCTTGGGGCAGG + Intergenic
1122077651 14:99246268-99246290 ATGGAGCAGCTGCCTGAGCCGGG - Intronic
1122500895 14:102198705-102198727 AGGGAGCAGGTGCACAAGGCAGG + Intronic
1202935722 14_KI270725v1_random:85957-85979 AGGAAGCAGATGCATGAGGCTGG - Intergenic
1125108538 15:36003334-36003356 TTGCAGAAGGTTAATGAGGCTGG - Intergenic
1125715173 15:41815588-41815610 TTAGAAAAGGTGGATGAGGCAGG - Intronic
1126668999 15:51099286-51099308 AGGCAGAGGGTGGATGAGGCTGG + Intronic
1127757339 15:62105346-62105368 AGGGAGAAGGAGCAGGTGGCAGG + Intergenic
1127845373 15:62866082-62866104 GTGGAGAAGGTGGATGAGGTTGG + Intergenic
1128114760 15:65098226-65098248 GAGGAGAGGGTGCATGAGGCAGG - Intronic
1128943967 15:71809337-71809359 ATGGAGAAGGTACTTGAACCTGG + Intronic
1129932257 15:79421680-79421702 ATGGAGTAAGTGAATGAGGGAGG + Intronic
1129935939 15:79450298-79450320 ACCCAGAAGGTGCATGAGACTGG - Intronic
1130558854 15:84943416-84943438 ATACAGAAGATGCATGAGGAGGG - Intronic
1130559388 15:84946608-84946630 ATACAGAAGATGCATGAGGAGGG - Intergenic
1134001591 16:10787139-10787161 ATGGAGCAGGAGCGTGGGGCTGG - Intronic
1134114028 16:11534622-11534644 AGGGAAAAGGTGCATAAGGCAGG - Intergenic
1134460908 16:14428446-14428468 ATGGAAAAGTTGCATGGGCCTGG + Intergenic
1137747188 16:50831143-50831165 ATGGAGAAGCTGCAGGAATCTGG - Intergenic
1137892775 16:52179918-52179940 ATGGAGAAGGTGCTTCTGGGAGG - Intergenic
1138552390 16:57754808-57754830 ATGGAGCAGGAGCATGGGGGAGG - Intronic
1139268241 16:65659430-65659452 ATGGAGAAGGTGCAGAGGGATGG + Intergenic
1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG + Intergenic
1139466892 16:67159040-67159062 ATGGGGAAGGTGAACCAGGCTGG + Intronic
1142014871 16:87740099-87740121 CTGGAGAAGGTGCAGGGGGTTGG - Intronic
1145278860 17:21454157-21454179 ATGGAGAGGGTGTGTGGGGCAGG + Intergenic
1145398999 17:22516323-22516345 ATGGAGAGGGTGTGTGGGGCAGG - Intergenic
1145399477 17:22519641-22519663 ATGGAGATGTTGGATGGGGCGGG - Intergenic
1147471520 17:40666484-40666506 ATGGGGAAGGTGCAGGAGGTAGG - Intergenic
1147656872 17:42096160-42096182 ATGGAGCAAGGACATGAGGCTGG - Intergenic
1147768074 17:42850104-42850126 ATGGGGAATGTGCAGGAAGCTGG - Exonic
1148937273 17:51173476-51173498 ATGGACCAGATGCATGGGGCAGG - Intergenic
1149007678 17:51822345-51822367 AGGGAGAGGTTGCATGAGCCAGG + Intronic
1151216346 17:72579341-72579363 ATGAAGAAGGTGTGTGAGGTTGG - Intergenic
1151399288 17:73845159-73845181 ATGGAGAAGCTGTGTGATGCTGG - Intergenic
1151811762 17:76447777-76447799 AAGCAAAAGGTGCACGAGGCGGG - Intronic
1155212991 18:23619158-23619180 AGGGAGGAGGGGCAAGAGGCAGG + Intronic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1157245197 18:46047576-46047598 AGCGAGAATGTGCCTGAGGCAGG + Intronic
1157287741 18:46388663-46388685 ATGAAGAAGGGGCTTGGGGCTGG + Intronic
1157442843 18:47723512-47723534 ATGGAGAAGGAGGATGGAGCTGG - Intergenic
1157762696 18:50275898-50275920 ATGGGGCAGCTGCAGGAGGCAGG + Exonic
1158555513 18:58471519-58471541 ATGGAGGAGGAGCAGCAGGCTGG - Intergenic
1159158353 18:64611478-64611500 ATGGAGAAGGCTCAAGAGGGAGG - Intergenic
1159949459 18:74471477-74471499 GAGGAGAAGGAGCAAGAGGCAGG - Intergenic
1161502239 19:4622780-4622802 CTGGAGAAGGTGGGAGAGGCTGG + Intergenic
1161852224 19:6743590-6743612 GTGGAGAAGGTGTGTGTGGCGGG + Exonic
1162462373 19:10820693-10820715 AGGGAGAGGGTGCATCAGGGAGG + Intronic
1163577462 19:18118992-18119014 AGGGATGAGGTGCAGGAGGCTGG + Intronic
1163784941 19:19270159-19270181 CTGCAGAAGGTGCAGGAGGCAGG - Exonic
1164388420 19:27795573-27795595 CTGGAGTAAGGGCATGAGGCAGG - Intergenic
1164535672 19:29084996-29085018 ATTCAGAAGGTGCTTGAGGTGGG - Intergenic
1165348913 19:35266318-35266340 CAGGAGAAGGGGGATGAGGCAGG - Intronic
1165421476 19:35724108-35724130 ATAGAGAAGGTGGCTGAGGGCGG + Intronic
1165999815 19:39871247-39871269 TTGGGGAAGGAGCATCAGGCTGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166304209 19:41928447-41928469 GAGGAGAAGGCGCAGGAGGCAGG - Intronic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1166743148 19:45126231-45126253 GTGGGGTAGGTGCATGTGGCAGG + Intronic
1167347470 19:48955362-48955384 ATGGAGAAAGGCCAGGAGGCTGG - Intronic
1167510851 19:49894753-49894775 ATGAAGAAGGGGCCTGGGGCTGG + Intronic
1168709092 19:58487863-58487885 ATGGAGAAAGGCCATAAGGCAGG + Intronic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
925361698 2:3284478-3284500 ATGGAGATGGGGCGGGAGGCCGG + Intronic
925373275 2:3362774-3362796 AAGGAGCAGGTGCTGGAGGCAGG + Intronic
926737153 2:16082295-16082317 AGGGATGAGGTGGATGAGGCTGG + Intergenic
927110566 2:19861273-19861295 TTGGAGAAGGTGCTAGAAGCTGG - Intergenic
928432166 2:31229189-31229211 AAGGAGAAGGGGCAGGAGACAGG + Intronic
929981689 2:46687276-46687298 ATGGAAAAGGTGAATTTGGCTGG + Intergenic
930232310 2:48855832-48855854 AAGCAGAAGGTACATGATGCAGG + Intergenic
930550327 2:52826569-52826591 ATAGAGAAGGTTGATGAGGAGGG + Intergenic
932460755 2:71880435-71880457 ATGTAGAGGGAGCATGAGGAAGG - Intergenic
932627485 2:73309119-73309141 AGGGACAAGGGGCATGAGGAAGG - Intergenic
934138650 2:89022709-89022731 ATGGAGATGGACCATAAGGCAGG + Intergenic
934144739 2:89080773-89080795 ATGGAGATGGACCATAAGGCAGG + Intergenic
934224516 2:90119778-90119800 ATGGAGATGGACCATAAGGCAGG - Intergenic
934230597 2:90177851-90177873 ATGGAGATGGACCATAAGGCAGG - Intergenic
934777782 2:96950036-96950058 ATGGAGACGGGGAAAGAGGCAGG + Intronic
937089908 2:119199234-119199256 ATGGAGAAAATGCATCAGGTCGG + Intergenic
937299544 2:120830672-120830694 CTGGAGAATGTGCAGGTGGCTGG + Intronic
937377231 2:121345710-121345732 CTGGAAGAGGTGTATGAGGCAGG - Intronic
938466870 2:131530386-131530408 ATGGAGAAGGGGGTTGAGGGAGG + Intronic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
939886791 2:147689916-147689938 ATGATGAAGATGCATGAGGAAGG - Intergenic
940603772 2:155894074-155894096 GTTGAGAAGATGCCTGAGGCTGG - Intergenic
941342396 2:164323605-164323627 ATGTAGTAGGTGCTTGAGACTGG - Intergenic
942073369 2:172335239-172335261 GTGAAGAAGGTGCAAGAGCCTGG - Intergenic
942530199 2:176901827-176901849 CTGAAGAAATTGCATGAGGCTGG - Intergenic
946872591 2:224097698-224097720 AAGGAGAAAGTGCAAGAGGCTGG - Intergenic
946944668 2:224808492-224808514 ATGGAGAAAGGACAGGAGGCTGG + Intronic
947206779 2:227667986-227668008 ATGGAGAAAGGGCAGGTGGCAGG - Intergenic
947742806 2:232492583-232492605 ATGGAGGAAGGGCAGGAGGCAGG - Intergenic
947946247 2:234105383-234105405 CTGGAGAAGGTAAAGGAGGCAGG + Intergenic
948295135 2:236855157-236855179 TGGGAGAAGGAGGATGAGGCAGG - Intergenic
948458848 2:238119540-238119562 ATGGAGGAGGTGGATGAAGGAGG + Intronic
948486318 2:238283544-238283566 CTGAGGAAGGTGCACGAGGCTGG + Intronic
948694317 2:239725544-239725566 AGGGAGAAGGTGAGTGAGGGAGG + Intergenic
949000942 2:241612788-241612810 ACGTAGAAGGCGCATGAGGAGGG + Intronic
1170652238 20:18253232-18253254 AGGGTAGAGGTGCATGAGGCCGG + Intergenic
1170786129 20:19469191-19469213 ATGAAGGATGTGCATGGGGCAGG + Intronic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1171224966 20:23434927-23434949 ATGGAGAAAGTGCCTTAGTCAGG - Intergenic
1171425705 20:25047271-25047293 AGAGGGAAGGTGCATGTGGCTGG - Intronic
1173790431 20:45824494-45824516 ATCGAGGAGGTGGATGAGGACGG - Exonic
1173861914 20:46289311-46289333 ATGGAGAAGGTGAAGAAAGCAGG - Intronic
1174188745 20:48725100-48725122 CTGGAGAAGGTGGGTGATGCTGG - Intronic
1174397524 20:50257009-50257031 CTGGAGGAGGTGGAAGAGGCTGG - Intergenic
1175654397 20:60755916-60755938 TTGGAGAAGGTGGGTGAGCCTGG + Intergenic
1176244364 20:64090476-64090498 ATGGAGAAGGTGCTCGGAGCAGG + Intronic
1176308943 21:5139629-5139651 ATGGAGAAGCTGCAGGAGCCTGG + Intronic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1176611894 21:8991218-8991240 AGGGAGAAGCTGGCTGAGGCAGG - Intergenic
1177722549 21:24927135-24927157 CTGGACAAGATGCATGACGCTGG - Intergenic
1179848118 21:44122404-44122426 ATGGAGAAGCTGCAGGAGCCTGG - Intronic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1181794386 22:25294396-25294418 ATGGAGGAGGTACATGGTGCAGG + Intergenic
1181902443 22:26168067-26168089 ATAAAGAAGGTGGCTGAGGCAGG - Intergenic
1182107467 22:27699574-27699596 GTGGAGAAGGTGCATGGAGTGGG - Intergenic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183508178 22:38220749-38220771 AGGGGGAAGGGGCATGAGGCAGG + Exonic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184297832 22:43537036-43537058 ATGGAAAAGGTGGAGGAGGGCGG - Intronic
1184326259 22:43789310-43789332 AAGGAGAAGGTGGAGGAGGAAGG + Intronic
1185273319 22:49938439-49938461 ATGGAGAAGGCGGATGGGGCAGG + Intergenic
949329094 3:2901480-2901502 ATGGAGAAGGTGCATGAGGCAGG - Intronic
949855502 3:8457579-8457601 ATGGATAAGGAGGCTGAGGCGGG + Intergenic
950186308 3:10947795-10947817 ATGGGGAAGGTGAAGGAGGGCGG + Intergenic
951473690 3:23082352-23082374 ATGCAGAAGGTCCATGGGACAGG + Intergenic
953082989 3:39638544-39638566 ATGGAAGAGGTGCATAGGGCAGG + Intergenic
955739202 3:62072088-62072110 AGGGAGAAGTTGCACAAGGCAGG + Intronic
956290084 3:67651999-67652021 TTGGGGATGGTGAATGAGGCAGG - Intronic
956421408 3:69089897-69089919 ATGGAGATGTTGCAGGAGGGTGG + Intronic
960641319 3:119826432-119826454 TTGTGGAAGGGGCATGAGGCAGG + Intronic
961047694 3:123720798-123720820 ATGGAGAATGTGACTGACGCTGG - Intronic
961366497 3:126402891-126402913 ATGGTGAGGGTGCAGGTGGCAGG + Intronic
961451990 3:127006404-127006426 GTGCAGAGGGTGCCTGAGGCTGG + Intronic
962207556 3:133447478-133447500 AGGTAGAAGGTGGATGATGCAGG - Intronic
962845967 3:139274164-139274186 AGGGAGGAGCTGCATGGGGCTGG - Intronic
963267852 3:143256694-143256716 ATAGAGAAGGGGCAGGAGACTGG + Intergenic
963460561 3:145608603-145608625 ATGGATAAAGTGCATGTTGCAGG - Intergenic
963793236 3:149605402-149605424 ATGGAGGAAATGTATGAGGCGGG + Intronic
966365755 3:179185772-179185794 ATGAAGAAGATGCATAGGGCAGG + Intronic
966861601 3:184233676-184233698 AAGGAGAAGGTATATGGGGCAGG - Exonic
967908561 3:194522148-194522170 ATGAGGCAGGAGCATGAGGCTGG + Intergenic
968978442 4:3834059-3834081 GTGGAGAAGGTGTGGGAGGCAGG - Intergenic
969235930 4:5865065-5865087 ATGGAGGAGGAGGAGGAGGCTGG - Intronic
969386883 4:6857365-6857387 CTGCAGATGGAGCATGAGGCTGG - Intronic
969728195 4:8938308-8938330 GTGGAGAAGGGGCATGCGGCAGG + Intergenic
972710742 4:41592062-41592084 AGGGAGAAGGGGCAGGAGGAGGG - Intronic
973262306 4:48177541-48177563 ATGGCCCAGGTGAATGAGGCAGG - Intronic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
975214768 4:71740513-71740535 ATGTAGAAGCTGCAAGCGGCAGG + Intergenic
976090428 4:81451826-81451848 GAGGAGAAGGTGCATGATGTAGG - Intronic
976848608 4:89518608-89518630 ATGAAGAAGGTGCATCAGCCTGG - Intergenic
980882329 4:138724558-138724580 ATAGAGAAGGGGAAAGAGGCAGG - Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
984988644 4:185355956-185355978 ATGGAGGAAGTGCATGCCGCAGG - Intronic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985046511 4:185946278-185946300 ATGTAGAAGTTGGAGGAGGCAGG + Intronic
985314426 4:188640481-188640503 ATGGAGAAAGGGCAAGAGGGAGG - Intergenic
987850325 5:23344392-23344414 TTGCAGAACGTGCATGAGGTTGG + Intergenic
989238316 5:39175138-39175160 AGGGAAAAGGGGCATGAGGTAGG + Intronic
990193854 5:53290764-53290786 ATGGGCAAGGTGCAGGAGCCAGG - Intergenic
992154768 5:73944439-73944461 AAGAAGAAGATGCTTGAGGCTGG + Intergenic
995271089 5:110220312-110220334 ATGAAGAAGCTGCATGGTGCAGG + Intergenic
995486086 5:112641336-112641358 TGGGAGAGGGTGAATGAGGCTGG + Intergenic
995667477 5:114559386-114559408 AATGAGAAGGGGCATGAGGAGGG + Intergenic
998378491 5:141707548-141707570 ATGGAAGAGGGGCAGGAGGCAGG + Intergenic
999250106 5:150177411-150177433 ATGCAGGAGGTGCATGGGGAAGG - Intronic
999275292 5:150325898-150325920 AGGGAAAAGGTGAGTGAGGCAGG - Intronic
999508280 5:152221077-152221099 CTGGAGAGTGTGCATGGGGCAGG + Intergenic
999940488 5:156537327-156537349 ATGCAGAAGGTACTAGAGGCAGG - Intronic
1000042428 5:157494747-157494769 TTCGAGAAGGTGAATGTGGCAGG - Exonic
1000188058 5:158880223-158880245 ATGGAGTATCTGCATGAGACGGG - Intronic
1000268949 5:159664726-159664748 GTGGAAAAGGAGCATGAGGGAGG - Intergenic
1000382072 5:160638233-160638255 ATGAAGAAAGTTCATGAGGAGGG - Intronic
1001136747 5:169108773-169108795 ATGGAGAAGCTCCAAGAGGGTGG + Intronic
1001699658 5:173697623-173697645 AGGGAGATGGTGCATAAGCCTGG + Intergenic
1001769498 5:174282543-174282565 ATGGCAAAGGTGCATGACCCAGG - Intergenic
1002473690 5:179452286-179452308 ATGGAGCAGGTGCATCTGACCGG - Intergenic
1003164406 6:3663718-3663740 CTGGAGAGGGTGCCAGAGGCAGG - Intergenic
1003277980 6:4668570-4668592 ATGGAGAGGGCACATGAGTCAGG + Intergenic
1003413350 6:5885725-5885747 ATGGAAAACGTGCATGAGGAGGG - Intergenic
1004702662 6:18093512-18093534 ATGGGGAAGCTGCACGGGGCAGG - Intergenic
1005900908 6:30215400-30215422 AGGGAGAAGTGGCATGAGGGAGG - Intergenic
1005966693 6:30731505-30731527 AAGGAGCAGGTGCATGAAGGTGG + Intronic
1006148503 6:31973121-31973143 TTGGAGATAGTGGATGAGGCAGG + Intronic
1006743333 6:36324439-36324461 AGGGAGAAGGTGCAGGATGAGGG - Intronic
1007302461 6:40877608-40877630 AAGGTGAAGGTGGAGGAGGCAGG - Intergenic
1011157627 6:84350669-84350691 AAGGTCAAGGTGAATGAGGCTGG + Intergenic
1011452316 6:87506891-87506913 ATGGAGTAGGATCATGAGGTGGG + Intronic
1012982971 6:105849623-105849645 ATAGAGAAGGTGCATTAGGCCGG + Intergenic
1013458844 6:110357093-110357115 TTGGAGAACGTGGTTGAGGCTGG + Intronic
1013467485 6:110430340-110430362 AGGGAGAATGTACATGAGGCTGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1016390042 6:143565645-143565667 ATGGAGCAGGGGCATTAGGTGGG + Intronic
1017044341 6:150333481-150333503 ATTGATAGGGTGCATGAGTCAGG + Intergenic
1017056516 6:150441492-150441514 TAGGAGAAGGTGGATGAGGAGGG - Intergenic
1017741797 6:157413067-157413089 AGGGAGACGGTGAATGAGGGAGG + Intronic
1018463230 6:164018784-164018806 ATGGAGGACCTCCATGAGGCTGG - Intergenic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1018986382 6:168640346-168640368 ATGGAGAGGAAGCATGGGGCAGG + Intronic
1019047794 6:169161806-169161828 ATGAGGGAGGCGCATGAGGCTGG - Intergenic
1019167475 6:170108334-170108356 AAGAAGCAGGTGCATGAGACGGG - Intergenic
1019468092 7:1201535-1201557 AGGAAGAAGATGCATGTGGCTGG + Intergenic
1019576381 7:1739631-1739653 GTGGGGAAGGTGAAGGAGGCTGG + Intronic
1019628362 7:2032904-2032926 AGGGAGAGTGTGCATGGGGCAGG + Intronic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1021809600 7:24390515-24390537 AGGGAGAAGGCCCATTAGGCGGG - Intergenic
1021838035 7:24699950-24699972 AGGGAAAAGGTTCTTGAGGCAGG - Intronic
1022330686 7:29375901-29375923 AAGGAGCAGGTGCATAATGCTGG + Intronic
1022673374 7:32476621-32476643 ATGGAGAAAGTGCAAGAGTTTGG + Intergenic
1024564847 7:50672733-50672755 ATGGCGAAGGTGCCCGAGGGTGG - Intronic
1028676844 7:93474170-93474192 CTGGGTAAAGTGCATGAGGCTGG + Intronic
1028686478 7:93594709-93594731 ATGCAGAACGTGGATGAGGAGGG + Intronic
1029206270 7:98870892-98870914 ATCAAGAAGGGGCAAGAGGCTGG - Intergenic
1029423678 7:100484153-100484175 ATGGAGAAGGGGGATGAAGCAGG + Intronic
1030608934 7:111668146-111668168 ATGGAGAAAGGCCATGAGCCAGG + Intergenic
1030878640 7:114848489-114848511 ATGAAGAAGGTGCATGAGATAGG + Intergenic
1031062525 7:117067939-117067961 ATGGAGAAATTTCATGAAGCTGG + Intronic
1033203404 7:139394342-139394364 ATGGGGAAGATGCATGAGAGGGG - Intronic
1033259567 7:139831166-139831188 CTGGAGAAGGTGCCCAAGGCAGG + Intronic
1035595313 8:853236-853258 AGGGAGAAGGTGGAGGAGGGAGG + Intergenic
1036221081 8:6922150-6922172 ATGGAGCAGGTGCCTGGGGGAGG - Intergenic
1036612983 8:10366000-10366022 AAGGAGCAGGGGAATGAGGCAGG - Intronic
1037097040 8:14998283-14998305 ATGGAAAAGATGCCTTAGGCTGG - Intronic
1037218336 8:16485295-16485317 ATGGAAATGGTGGATGAGGTGGG - Intronic
1038210709 8:25516969-25516991 ATGGAGGCGGTGGCTGAGGCAGG - Intergenic
1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG + Intergenic
1041050320 8:53927804-53927826 AAGGAGAAGATGTATGAAGCTGG + Intronic
1041646054 8:60253728-60253750 ATGGGAAAGTAGCATGAGGCAGG - Intronic
1043890348 8:85646371-85646393 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043891963 8:85658561-85658583 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043894141 8:85724136-85724158 ATGGAGAAAGGGCTTCAGGCTGG + Intergenic
1043894497 8:85727221-85727243 ATGGAGAAAGGGCTTCAGGCTGG + Intergenic
1043894853 8:85730306-85730328 ATGGAGAAAGGGCTTCAGGCTGG + Intergenic
1043895209 8:85733391-85733413 ATGGAGAAAGGGCTTCAGGCTGG + Intergenic
1043897467 8:85748417-85748439 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043897823 8:85751505-85751527 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043898179 8:85754590-85754612 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043899793 8:85766785-85766807 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043901400 8:85778978-85779000 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043901755 8:85782063-85782085 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043903365 8:85794253-85794275 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043904976 8:85806446-85806468 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043906587 8:85818637-85818659 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1044235849 8:89829244-89829266 AGGGAGTAAGTGCATGTGGCAGG - Intergenic
1045058322 8:98389191-98389213 ATGGAGAAGGTGAAACAGGCTGG - Intergenic
1046035089 8:108831312-108831334 AAGGAGAGGTTGCATGGGGCCGG - Intergenic
1047734591 8:127754285-127754307 CTGGTGAGGGTTCATGAGGCTGG - Intergenic
1048220024 8:132532602-132532624 TTGGAGAGGCTGCCTGAGGCTGG - Intergenic
1049006409 8:139858441-139858463 ATGGAAGAGCTGCATGCGGCTGG - Intronic
1049639932 8:143710988-143711010 ATGGAGTTGGTGGGTGAGGCAGG - Intronic
1050388169 9:5111770-5111792 AAGGAGAAGGTGGATGCAGCCGG - Intronic
1051250050 9:15150459-15150481 AGGGAGAAGGTGAGTGTGGCTGG + Intergenic
1051418595 9:16870020-16870042 ACGGAGAAGGTGCAGAACGCAGG - Intronic
1052801645 9:32973625-32973647 ATCGAGATGGTACAAGAGGCTGG - Exonic
1053157778 9:35792253-35792275 ATGCAGAAGGTGCTGGGGGCCGG - Exonic
1054849013 9:69827516-69827538 AAGGAGAAGGTGGAGGAGGAAGG - Intronic
1055022483 9:71685018-71685040 AACTAGAAGGTGCATGAAGCTGG + Exonic
1055200072 9:73648544-73648566 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1055481984 9:76717686-76717708 ATGCAGAAGGTGTGTGTGGCTGG - Intronic
1056699028 9:88887012-88887034 ATAGAGAAGGCCCATCAGGCGGG + Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1059526479 9:114995713-114995735 AGAGAGAAGGTGCAGGAGACAGG - Intergenic
1059745035 9:117191933-117191955 ATGGAAAAGGATCATGAGGGAGG + Intronic
1060045207 9:120334820-120334842 ATTGGGAAGGTGCATTTGGCTGG - Intergenic
1060393622 9:123300360-123300382 AGGGATTAGGGGCATGAGGCTGG - Intergenic
1060625148 9:125105494-125105516 GTGGAGAAGGGACATGAGACAGG - Intronic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061807985 9:133147182-133147204 ATGGAGAAGGCTCAGCAGGCAGG - Intronic
1062113537 9:134795730-134795752 GGGAAGAATGTGCATGAGGCCGG - Intronic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1185648532 X:1632083-1632105 ATGGACAAGGAGCATGGGGCTGG + Intronic
1186034233 X:5403434-5403456 ATGGTGAAGGTGCATCAGTCAGG + Intergenic
1187069781 X:15877145-15877167 ATGGAGAAGTTGGAAGGGGCAGG + Intergenic
1188839838 X:35002644-35002666 AACAAGAAAGTGCATGAGGCAGG - Intergenic
1189316546 X:40061017-40061039 ATGGTTAAGGTGCATGAGCCTGG + Intronic
1191912715 X:66168067-66168089 ATGAAGACAGTTCATGAGGCAGG + Intronic
1193929662 X:87536750-87536772 ATGAAGAAGGTGCAAGTGGGGGG + Intronic
1195329000 X:103781182-103781204 ATGGAGCTGGTCCTTGAGGCGGG + Intronic
1197100218 X:122644467-122644489 ATAGAGAACGTGCATGGAGCAGG - Intergenic
1198067909 X:133118278-133118300 ATGGAGGAATTGCATGAGGAAGG + Intergenic
1198176780 X:134164344-134164366 ATTAAGAGGGTGCCTGAGGCCGG + Intergenic