ID: 949331621

View in Genome Browser
Species Human (GRCh38)
Location 3:2929941-2929963
Sequence TGGGGATCCCTGCCCTGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949331621_949331633 21 Left 949331621 3:2929941-2929963 CCATGCCAGGGCAGGGATCCCCA 0: 1
1: 0
2: 3
3: 39
4: 307
Right 949331633 3:2929985-2930007 TCCCTGGTTACTAATAATGATGG 0: 1
1: 0
2: 3
3: 16
4: 156
949331621_949331629 5 Left 949331621 3:2929941-2929963 CCATGCCAGGGCAGGGATCCCCA 0: 1
1: 0
2: 3
3: 39
4: 307
Right 949331629 3:2929969-2929991 GCTGGGCCCACATCCTTCCCTGG 0: 1
1: 0
2: 2
3: 38
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949331621 Original CRISPR TGGGGATCCCTGCCCTGGCA TGG (reversed) Intronic
900007458 1:72018-72040 TGGGCATCCCTCCCCTGGGAAGG + Intergenic
900595104 1:3476970-3476992 AGGGGGTCCTTGCTCTGGCAGGG - Intronic
900609979 1:3540528-3540550 TGGGGAAGGCTGCCCTCGCAGGG - Intronic
900703834 1:4063689-4063711 TGGTGGTCCCTGACCTGGGAAGG + Intergenic
900803883 1:4754968-4754990 TGGGGGTTCCTGCCCAGGCAGGG - Intronic
900865283 1:5264527-5264549 TGTGAATCTCAGCCCTGGCAGGG + Intergenic
901065303 1:6491380-6491402 TGGGGATCCCTGGCCCAGCCAGG - Intronic
901871173 1:12140176-12140198 TGGGCTGCCCTCCCCTGGCATGG + Intronic
902230680 1:15025512-15025534 TAGGGATGTCTGCCATGGCACGG - Intronic
903343636 1:22670789-22670811 TGTGGATACCTGTGCTGGCATGG - Intergenic
903557287 1:24203086-24203108 TGGGGATGTATGCCCTGGCGGGG - Intergenic
903735758 1:25529043-25529065 GTGGGAGCCCTGCCCTGGCCTGG + Intergenic
903930444 1:26859068-26859090 TGGAGCTCCATGCCCTGCCAGGG + Intergenic
904357265 1:29948414-29948436 TGGGGTTGACCGCCCTGGCAGGG + Intergenic
904540640 1:31230609-31230631 TGGCTTTCCCTGCCCTGGCCTGG - Intronic
904751281 1:32742408-32742430 AGGGGATCCCTGCCCCAGCCGGG - Intronic
906670685 1:47652220-47652242 AGGGGATTCCTACTCTGGCAGGG + Intergenic
907665761 1:56432760-56432782 AGGTGATCCCTGCCCTGCCAGGG + Intergenic
907912821 1:58841615-58841637 TGGGGTTCCCTGGCCTGCCCTGG - Intergenic
911371811 1:97003248-97003270 TGAGGCTTGCTGCCCTGGCATGG + Intergenic
911912655 1:103654872-103654894 CGGGGATCACTGCTCTGGCGAGG + Intergenic
911915799 1:103697076-103697098 CGGGGATCACTGCTCTGGCGAGG - Intronic
911920067 1:103749010-103749032 CGGGGATCACTGCTCTGGCGAGG + Intronic
912204704 1:107496852-107496874 TGGTGATCCCGTCCCTGGCCTGG - Intergenic
912365781 1:109132666-109132688 TGCTGATCCCTACCCTTGCATGG - Intronic
912552494 1:110493212-110493234 TGGTGACCCCTGTCCTGGGAGGG + Intergenic
915079497 1:153342060-153342082 TGGGAAACCCTGGCCTGGCCTGG - Intronic
915145408 1:153793650-153793672 TGGGGATCCATGTCCTGGACAGG - Intergenic
915259474 1:154666037-154666059 GGTGGATCCCTGGCCTGGCGTGG - Intergenic
915911475 1:159918255-159918277 TGGGGCAGCCTTCCCTGGCAGGG - Exonic
915981012 1:160419999-160420021 TGGGGATCCCTCCTCTGGCCAGG - Intronic
919168653 1:193927193-193927215 TGGAGCTGCCTGCCCTGCCACGG - Intergenic
924591016 1:245404415-245404437 TGGGGATCCCTGAGGTGTCAGGG + Intronic
1063232958 10:4083957-4083979 TGCACATCCCTGCACTGGCAAGG - Intergenic
1063764826 10:9126967-9126989 TGGGGCTCTCTGCTCTGGCAGGG + Intergenic
1064392785 10:14955918-14955940 TGGGAACAACTGCCCTGGCAGGG + Intergenic
1064607764 10:17061636-17061658 GTGGGAACCCTGCCCTGGGAAGG + Intronic
1064766652 10:18682086-18682108 GGGGAATCCCTGGCCTGGGAAGG + Intergenic
1066050840 10:31633394-31633416 TGGGGAACCCTGCTCTGGGTTGG - Intergenic
1066245603 10:33580725-33580747 TGGGGAACCGTGCCATGGTAAGG + Intergenic
1068838974 10:61589084-61589106 TAGGTCTCCCTGGCCTGGCACGG - Intergenic
1069885878 10:71623318-71623340 TGGGGATCTCTGCCCTTGTAGGG - Intronic
1070799859 10:79238994-79239016 TGGGGATGCCTGCATTGGCCAGG + Intronic
1072285026 10:93905918-93905940 TGGAGCTCCCAACCCTGGCATGG - Intronic
1072971668 10:100022816-100022838 TGGGGGTCCCTGGCCAGGCACGG + Intergenic
1073123750 10:101137017-101137039 AGGGGAACACTGCCCTCGCACGG + Exonic
1073190471 10:101647159-101647181 TAGGCATCCCTGCCCAGGCCTGG - Intronic
1073445903 10:103580130-103580152 GGGACCTCCCTGCCCTGGCAGGG + Intronic
1074382329 10:112991237-112991259 TGGGGAACCCTGGCCGGGCGCGG + Intronic
1075131971 10:119748167-119748189 TGGAGCTGCCTGCCCTGCCACGG - Intronic
1075414266 10:122250600-122250622 TGGTGATCTCTGCCCTGGGCAGG + Intronic
1075473275 10:122710196-122710218 TAGGAACCCCTGCCTTGGCAGGG - Intergenic
1075572788 10:123557643-123557665 GGGGCACCCCTGCCCTGGCCTGG - Intergenic
1076035201 10:127194797-127194819 GGGGGAGCCCTGCCTTGGCTGGG - Intronic
1076453081 10:130570393-130570415 TGGGGAAGCCTGGCCTGGCGTGG - Intergenic
1077353367 11:2103301-2103323 TGGTCCTCCGTGCCCTGGCAAGG - Intergenic
1080272685 11:30467425-30467447 TGGGGATCCCTTCCCAAGCTGGG - Intronic
1080581754 11:33650187-33650209 TGGGGCTCTCTGCCTTGGAACGG + Intronic
1083179733 11:60977411-60977433 TGGGGATCCCAGCCCTACCAGGG - Intronic
1083636488 11:64123560-64123582 TGGGGGCACCTGCCCTGGCTTGG + Intronic
1083645137 11:64167765-64167787 CGAGGATCCCTGACCTGCCATGG + Intergenic
1084890761 11:72235837-72235859 TGCGGCTCCCTGACCTGCCAGGG - Exonic
1085453996 11:76655687-76655709 TGGGGTTCCATGCGCTGGCGTGG - Intergenic
1088756165 11:112887090-112887112 TTGGAATCCCAGCCCTGCCAAGG - Intergenic
1089125359 11:116172769-116172791 AGGGGATCCCTGCCCTGTATGGG - Intergenic
1089398030 11:118148530-118148552 GAGGCATCCCTGCCCTGGCTTGG - Intronic
1089683750 11:120133935-120133957 TGGGGGGCCCTGCACTGTCATGG - Intronic
1089698302 11:120229121-120229143 TGAGGATCCCTACCCAGGCTAGG + Exonic
1090425281 11:126603173-126603195 CTGGGATCCTTGCCCTGGCATGG - Intronic
1091224500 11:133949597-133949619 TGTGGAGCCCAGCCCTGGGAGGG + Intronic
1095426806 12:42083741-42083763 TGGGAATCACTGCCCTGCCTTGG - Exonic
1095749785 12:45697353-45697375 TGGGCATCCCTGCACTCTCAGGG - Intergenic
1095946783 12:47758345-47758367 TGGAGATCCCTGCAGGGGCATGG - Intronic
1095951001 12:47781924-47781946 TGGGCATCCTTGCCCTGGCTGGG - Exonic
1096460443 12:51819130-51819152 TGGGGACCTCTGCCAAGGCAGGG + Intergenic
1096514729 12:52149563-52149585 TGGTGCTCTCTGCCCTGGAAAGG + Intergenic
1096718578 12:53505302-53505324 CCTGGAGCCCTGCCCTGGCATGG - Intronic
1097550706 12:61064924-61064946 TGGGGATTCCTGCCCCAGCAGGG + Intergenic
1099376105 12:81897748-81897770 TGGAGATCCCTTCCCTCTCAAGG + Intergenic
1103844435 12:123891689-123891711 GAGGGATCCCTCCCTTGGCAGGG - Intronic
1104857063 12:131907354-131907376 TGGGGACACCTGCCCTGGGCTGG + Intronic
1105406909 13:20140727-20140749 TGGGGATCCCTGCCTGGGGGAGG - Exonic
1106021198 13:25917180-25917202 GAGAGATCCCTGCCCTGGCCTGG - Intronic
1106480523 13:30133798-30133820 TGGGGCTCCCAGCTCTGGCCCGG - Intergenic
1110114414 13:71794311-71794333 TGGTTAGTCCTGCCCTGGCAAGG - Intronic
1111354537 13:87080580-87080602 TGGGCATCCCTGCGCTCTCAGGG - Intergenic
1112282255 13:98073347-98073369 TCTGGATCCCAGCCCTGGCTGGG + Intergenic
1112331379 13:98479487-98479509 TGGGCATCCCTCAGCTGGCAGGG - Intronic
1113075244 13:106461605-106461627 TGGTGATGCCTGGCCAGGCACGG + Intergenic
1113919907 13:113901442-113901464 TGGCGGTCCCAGCCTTGGCAAGG - Intergenic
1114910869 14:27194148-27194170 AAGGGATACCTGCCCTTGCATGG + Intergenic
1119678586 14:76574893-76574915 TGGGGTTCCCAGCCCCGGCGGGG + Intergenic
1121146906 14:91592319-91592341 TCTGGATCCCTGCACTGGCAGGG - Intronic
1121259765 14:92557698-92557720 GGGGGACCGCTGGCCTGGCAAGG + Intronic
1122328913 14:100899895-100899917 TGGGTCTCCCTGCCCTGAAAGGG - Intergenic
1122374567 14:101249271-101249293 GGGAGAGCCCTGCCATGGCACGG - Intergenic
1122583217 14:102784846-102784868 TGGGGAAGCCTGGGCTGGCAGGG + Intronic
1122891268 14:104733308-104733330 TGGGGACTCCTGCCCTGCGAAGG + Intronic
1124005526 15:25792769-25792791 ATGAGAGCCCTGCCCTGGCAGGG - Intronic
1125647170 15:41282528-41282550 TGCAGATTCCTGGCCTGGCACGG - Intergenic
1125928661 15:43584162-43584184 TAGAAATCCCTGCCCTGGCCGGG - Intronic
1125941827 15:43683997-43684019 TAGAAATCCCTGCCCTGGCCGGG - Intergenic
1128737371 15:70060802-70060824 TGGGGAAGGCTTCCCTGGCAAGG - Intronic
1128979846 15:72178222-72178244 TGGGGTTCCCTGCCTTGTCAAGG - Intronic
1130667927 15:85885431-85885453 TGGGAATTCCTGGGCTGGCAAGG + Intergenic
1132446092 15:101920110-101920132 TGGGCATCCCTCCCCTGGGAAGG - Intergenic
1132908935 16:2298654-2298676 TGGGGTTCCGTGCCCTCTCATGG - Intronic
1133181595 16:4058791-4058813 TGAGGAGCCCTTTCCTGGCAAGG - Intronic
1133228869 16:4356951-4356973 GTGGGAGCCCTGCCCTGGCCAGG - Intronic
1134065238 16:11224286-11224308 CGGGGACCTCTGCCCTGGCCTGG - Intergenic
1136281890 16:29218177-29218199 TGCAGATCCCAGCCCGGGCAGGG - Intergenic
1136355829 16:29744476-29744498 TGGGGGCCCCAGCCCTGGGAGGG - Exonic
1136716293 16:32286424-32286446 GGGGCATCCCTGCCCTCCCAGGG + Intergenic
1136834679 16:33492702-33492724 GGGGCATCCCTGCCCTCCCAGGG + Intergenic
1137264069 16:46854316-46854338 TGGAACTCCCTGCCCTGTCAGGG + Intergenic
1138528429 16:57621866-57621888 TAGGGGTCCCAGCCTTGGCATGG - Intronic
1138909672 16:61381056-61381078 TGGGAATTACTGCCCTGGGAGGG - Intergenic
1139015402 16:62683947-62683969 TGGGTATCCCTGCACTTTCATGG + Intergenic
1139024970 16:62805322-62805344 CTGGGCTCCCTGCCCAGGCAGGG + Intergenic
1139251958 16:65505271-65505293 TTGGGCTCTCTGCCCTGCCAGGG + Intergenic
1141464137 16:84195601-84195623 TGGGGGTCCGGGCCCTGGCTGGG - Exonic
1141631714 16:85291532-85291554 TGGGGAAGTCTGCCCTGCCAGGG - Intergenic
1141729509 16:85812292-85812314 TGTGGATCCCTGCCCGGGGACGG - Intergenic
1141935849 16:87237220-87237242 TGGGGGTCCCTCCCCTGCCCGGG - Intronic
1142086264 16:88184093-88184115 TGCAGATCCCAGCCCGGGCAGGG - Intergenic
1142204784 16:88777821-88777843 TGGGGCTGCCTGCCCTGGAGGGG - Intronic
1142289333 16:89185566-89185588 TGGGGAGCCCTGCCCTGTGCCGG - Intronic
1203010124 16_KI270728v1_random:231330-231352 GGGGCATCCCTGCCCTCCCAGGG - Intergenic
1203144848 16_KI270728v1_random:1792990-1793012 GGGGCATCCCTGCCCTCCCAGGG + Intergenic
1142566107 17:841343-841365 TCTGGGTCCCAGCCCTGGCAGGG - Intronic
1143118978 17:4595712-4595734 TGGGGCTCCCAGCTCTGGCCAGG - Intronic
1143700008 17:8651370-8651392 TGAGGATGCCACCCCTGGCAGGG - Intergenic
1143764687 17:9129823-9129845 TGGTGGTCCCAGACCTGGCAAGG + Intronic
1143768726 17:9154239-9154261 TCATGGTCCCTGCCCTGGCAGGG - Intronic
1143837089 17:9701255-9701277 TGGGGGTCCATGCCCCGGCCGGG + Intronic
1144584547 17:16480337-16480359 TGGAGACCGCTGCCCGGGCACGG + Intronic
1144653553 17:17021506-17021528 TGCGGCTCCCTGCTGTGGCACGG - Intergenic
1145249892 17:21291594-21291616 TGGGTCCCCCTGCCCTGTCATGG + Intronic
1145749432 17:27344596-27344618 TAAGGATCCCTGGCCAGGCACGG + Intergenic
1145767913 17:27472016-27472038 TGAGGACCCCTTCCCTGGCAGGG - Exonic
1146631443 17:34473151-34473173 TGGGGAGACCTGCCCAGGCCAGG - Intergenic
1147161548 17:38572033-38572055 TGGGGATGCCTGCCCAGGGGAGG - Intronic
1147316569 17:39623668-39623690 TCAGGAACCCTGCCCTGGCGGGG + Intergenic
1147403398 17:40194194-40194216 TGGGGGTCCCAGCCCTGACCAGG - Exonic
1148053919 17:44782300-44782322 TGGGAGTCCCTCCCCTGGCTGGG + Intergenic
1148213978 17:45824568-45824590 TAGAGACCCCTGTCCTGGCAGGG - Intronic
1148655211 17:49278137-49278159 TTGGGATCTCAGCCCTGGGATGG - Intergenic
1149772192 17:59331321-59331343 TGGGAATCCCAGCCCTGCCCTGG + Intergenic
1151309705 17:73285709-73285731 TGGCGGCCCCTCCCCTGGCAAGG - Exonic
1151595977 17:75078198-75078220 TGGGGACCCAAGCCCAGGCAGGG + Intergenic
1152286525 17:79416104-79416126 TGGGCAGCCCTGCCCTGCCTGGG - Intronic
1152784661 17:82241521-82241543 TGGGGTTCCCTGCCCTGAGAGGG - Intronic
1153357094 18:4149522-4149544 TAGGGATCCCTGCAAAGGCAAGG - Intronic
1153472987 18:5467930-5467952 TGGGCATCCCTGCACTCTCAGGG + Intronic
1156875349 18:42003926-42003948 TGGGAATTTCTGCCCTAGCATGG + Intronic
1157538106 18:48475924-48475946 TGGTGAAGGCTGCCCTGGCATGG + Intergenic
1157569538 18:48703387-48703409 TGGGGATCCTAGCCCAGGCCAGG - Intronic
1159393870 18:67830954-67830976 AAGGGATCCCAGCCTTGGCAGGG - Intergenic
1160639215 19:113605-113627 TGGACATCCCTCCCCTGGGAAGG + Intergenic
1160777459 19:862572-862594 GCGGGATCCCTGCTGTGGCAGGG + Intronic
1161390818 19:4019365-4019387 CTGGGGTCCCTGCCCTGGGAGGG - Intronic
1162525018 19:11201861-11201883 TGGGGATCCTGGGCCTGGCGGGG - Intronic
1163157909 19:15449343-15449365 TGGGGGTCCCTACCCAGGCCCGG + Intronic
1163582221 19:18145673-18145695 TGGGGACCCCAGCCCAGGCTGGG - Intronic
1163700060 19:18782461-18782483 TGGGGACCCCTTCCCTTGCCTGG - Intergenic
1164593657 19:29519832-29519854 TAGTGATCCCAGCCCTGGCAGGG - Intergenic
1166130411 19:40742643-40742665 CGGGGAGCCCTCCTCTGGCAGGG + Exonic
1166347419 19:42175322-42175344 TGGGGATTCCTGCCTTTGCATGG + Intronic
1166382247 19:42361160-42361182 TGGGGATCCCTGCCTGGGACTGG + Intronic
1166908697 19:46134850-46134872 TGGGGACCCCTGCTCTAGTAGGG + Intergenic
1167721909 19:51185301-51185323 TTGGGACCCCTGTCCTGGGAGGG + Intergenic
1168019116 19:53595855-53595877 TGTGGGTCCCTGGCCGGGCATGG + Intergenic
1168301465 19:55407455-55407477 TGGGGGTCCCTGACCCGGGATGG - Intronic
1168477691 19:56688991-56689013 TGGGAATTCTGGCCCTGGCATGG - Intergenic
925237175 2:2289996-2290018 TGGGGATCCCAGCCCTGCTATGG - Intronic
926036422 2:9639421-9639443 TCCAGATCCCAGCCCTGGCAGGG - Intergenic
926131259 2:10304213-10304235 TGGGGGTCCCTCTCCTGGCCGGG + Intronic
926356588 2:12046447-12046469 TGGGGCTACCTGCCCTGGTTTGG + Intergenic
927524192 2:23721903-23721925 TGGTGAGCCCATCCCTGGCAAGG + Intergenic
928087314 2:28353887-28353909 TGGGGATCACTGGACTGGGAAGG + Intergenic
928327172 2:30328576-30328598 TTGGGAATCCTCCCCTGGCAAGG - Intergenic
928427854 2:31193381-31193403 TGGGCATCCCAGCCCTCTCATGG + Intronic
928436994 2:31261122-31261144 TGGGATTCCCAGCCTTGGCAAGG + Intronic
929847247 2:45542366-45542388 TGGGCATCCCTGCACTCTCAGGG - Intronic
933992049 2:87640834-87640856 GGGAGAACCCTGCCCTGGCCTGG - Intergenic
934768468 2:96893788-96893810 TGTTGGTCTCTGCCCTGGCATGG + Intronic
936301794 2:111309984-111310006 GGGAGAACCCTGCCCTGGCCTGG + Intergenic
936484514 2:112914755-112914777 AGGAGATCCCAGCCCTGACAAGG - Intronic
937251357 2:120525915-120525937 TGCTGAGCCCTGCTCTGGCAGGG - Intergenic
937385508 2:121428269-121428291 TGGGGTTCCCTGCCCCAGCTAGG - Intronic
938068030 2:128292388-128292410 TGGGCGTCCCTGCCCTGAGAAGG - Intronic
938242232 2:129752299-129752321 TGGCCATGCCTGCCCAGGCAAGG - Intergenic
939615339 2:144356039-144356061 GGGGGACCCCTGACCTGGGATGG - Intergenic
940582715 2:155601404-155601426 TGGGCATCCCTGTCCTCTCAGGG - Intergenic
943700065 2:190979994-190980016 ATGGGATCCCTCCCCTGGCAGGG + Intronic
946227944 2:218274544-218274566 TGGGGGTCCCTCACCTGGCTAGG - Exonic
947398003 2:229705626-229705648 TGGGGATCTGAGCCCAGGCATGG - Intronic
947640984 2:231707868-231707890 AGGGGTGCCCTGCCCTGGGAGGG + Intronic
947812249 2:233011863-233011885 TGGGGATCCCCTCCCTGGGAGGG + Intronic
948271656 2:236678514-236678536 TGGGGGTCACTGCTCTGCCAGGG - Intergenic
1168788844 20:562627-562649 TGGCCATCCCTGGCCTGGCTGGG + Intergenic
1169084294 20:2817099-2817121 CAGGGCTCCCTGCCTTGGCAGGG + Intronic
1172613207 20:36266767-36266789 TGGGGATAGCTGCCCTGGCTGGG - Intronic
1175535538 20:59708415-59708437 TGGAGAACCGTGCCCTGGCTGGG + Intronic
1175912880 20:62413095-62413117 TGGGGTTCCCGCCCCTGGCTTGG + Intronic
1175919581 20:62444409-62444431 TTGAGATCCATGCCCAGGCAGGG - Intergenic
1176095811 20:63343859-63343881 CGGGGGTCACAGCCCTGGCAAGG + Intronic
1176305948 21:5123251-5123273 GGGGGCTCCGTGCCCTGGCATGG - Intronic
1178122351 21:29482096-29482118 TGGGTTTTCCTGCCCTGGCCTGG + Intronic
1178450285 21:32692284-32692306 TGAGGATTCCTGGCCGGGCACGG + Intronic
1178947279 21:36959111-36959133 TGGGCATCCCTGCACTCTCAGGG + Intronic
1179270287 21:39845377-39845399 TGTGGATCCCATCCCTGGCCTGG - Intergenic
1179851109 21:44138780-44138802 GGGGGCTCCGTGCCCTGGCATGG + Intronic
1180046705 21:45309743-45309765 TCTGCATCCCTGCCCTGGCCAGG + Intergenic
1180727892 22:17960139-17960161 TGTGGCTCCCTGCCCCAGCATGG + Intronic
1181037030 22:20174685-20174707 TGGAGACCCCTGCCGAGGCAGGG - Intergenic
1181562676 22:23714883-23714905 TGGGGGTCCTTGCCCTGCCCTGG - Intergenic
1181604240 22:23970819-23970841 TGGGGACCCCTGGGCTGGAAAGG + Intronic
1181816207 22:25438468-25438490 TGGGGCTCTCTGGCCTGGCACGG + Intergenic
1182428040 22:30285223-30285245 TGGGGTTGCCTTCCCTGGCCAGG - Exonic
1182723448 22:32423322-32423344 TGGGGTTTCCTCCTCTGGCAGGG + Intronic
1183022108 22:35035496-35035518 GGAAGATTCCTGCCCTGGCATGG + Intergenic
1183213229 22:36463823-36463845 CGGGGACCCCAGCCCTGGCCAGG + Intergenic
1183358213 22:37370553-37370575 TGGGGCTGCCCTCCCTGGCATGG + Exonic
1183521810 22:38299987-38300009 CTGGGCTCCCTGCCCTGGCAGGG - Exonic
1183622537 22:38982731-38982753 TGGTGCTCCCCGCCCTGGGAGGG + Intronic
1183623395 22:38987446-38987468 TGGTGCTCCCTGCCCTGGGAGGG + Intronic
1183632428 22:39041247-39041269 TGGTGCTCCCGGCCCTGGGAGGG + Intronic
1183638245 22:39077643-39077665 TGGTGCTCCCGGCCCTGGGAGGG + Intronic
1184121057 22:42450622-42450644 CAGGAATCCCTGCCTTGGCAGGG + Intergenic
1184132890 22:42528348-42528370 CAGGAATCCCTGCCTTGGCAGGG + Intergenic
1184159190 22:42687932-42687954 TTGGGACCCCTGCCCTGCCCCGG - Intergenic
1184424270 22:44400059-44400081 TGGGGTTGACTGACCTGGCAAGG - Intergenic
1184942493 22:47779456-47779478 TGGCGAATCCTGCCCTGGTAAGG + Intergenic
949331621 3:2929941-2929963 TGGGGATCCCTGCCCTGGCATGG - Intronic
952959181 3:38579165-38579187 TGGGCATCCCTGTCCTGACAGGG - Intronic
953575631 3:44111103-44111125 TGAAGACCCCTGCTCTGGCAGGG + Intergenic
954108559 3:48421936-48421958 TGGGCATCAGTGCCCTGCCAGGG - Intronic
954632835 3:52056396-52056418 CGGGCAGCCCTGCCCTGGGACGG + Exonic
954671586 3:52294009-52294031 TGGGGGTCCCAGCACTGGGATGG + Intergenic
960963601 3:123089648-123089670 TGGTGAAGCATGCCCTGGCAGGG - Intronic
961057759 3:123803622-123803644 GGGGGATCCAAGCCCAGGCAGGG + Intronic
961090944 3:124112346-124112368 TGAGCATCCCTTCCCTAGCAGGG + Intronic
961442341 3:126960500-126960522 GGGGAGTCCCTGGCCTGGCAGGG + Intergenic
961521023 3:127467417-127467439 TGGGGGTCCCTGGCCAGGGAGGG + Intergenic
961819008 3:129565752-129565774 TGGGCATCCCGGCCCAGGAAGGG + Intronic
962737513 3:138339027-138339049 ATGAGATCCCAGCCCTGGCAAGG + Intergenic
964927366 3:161975368-161975390 TGGGCATCCCTGCACTTTCAGGG - Intergenic
965132813 3:164723485-164723507 TGCCTATCCCTGCCCTGGCCTGG - Intergenic
965613069 3:170565165-170565187 TAGGAATCCCTGGCCTGGCAGGG + Intronic
968521714 4:1037276-1037298 TGAGGGTCCCTGCCCAGGGAGGG + Intergenic
968830576 4:2931351-2931373 TGAGTGGCCCTGCCCTGGCAGGG - Intronic
968956835 4:3723773-3723795 TCAGGCTCCCTGCCCTGGCCTGG + Intergenic
973536861 4:51891873-51891895 TGGGGGTCCCTGCCCTTCCCAGG + Intronic
973627638 4:52789234-52789256 TGGGGCTTCCAGCCCTGGCCAGG - Intergenic
976822930 4:89227197-89227219 TGGGTTTCACTGCCCTGGCAAGG + Intergenic
977958138 4:103053985-103054007 AGGTGATTCCTGGCCTGGCATGG + Intronic
978367939 4:108002152-108002174 TGGGGACCCCTGCTCTGGAGGGG - Intronic
981654367 4:147096357-147096379 TGGGGATCCTTGCACTGGGGAGG - Intergenic
982062832 4:151621945-151621967 TGGGGATGCCTTCCTTAGCAGGG - Intronic
982313657 4:154010242-154010264 AGGGGCTCCCTGCCCAGGCAAGG + Intergenic
985062988 4:186096646-186096668 TGCAGATCCTTGCACTGGCACGG - Intergenic
985986402 5:3520320-3520342 TGGGGATGCTTTCCCTGGCTGGG + Intergenic
988482141 5:31639556-31639578 CGGGAATCCCAGCCCTGGCAGGG + Intronic
989313049 5:40043160-40043182 TGGGAATCACTGGCCGGGCACGG - Intergenic
989572898 5:42961520-42961542 TGGGGATCCCAGTCTTGGAATGG + Intergenic
989730555 5:44642273-44642295 TGGGCATCCCTGCACTCTCAGGG - Intergenic
991023736 5:62007965-62007987 TGGGGAGCCCTGTCCTGCTATGG + Intergenic
991497327 5:67239421-67239443 TGGGAACCCCTCCCCTGACAAGG - Intergenic
997285213 5:132673005-132673027 TGGGCATTCCTGGCCAGGCATGG + Intergenic
997383406 5:133453691-133453713 TGGGGATCAGTGCCCTTGCTTGG - Intronic
997436279 5:133877963-133877985 TGGGGATTCCTGGGCTGGAATGG - Intergenic
999449511 5:151667634-151667656 TGGGGAGCACGGCCCAGGCAGGG - Intronic
1000323863 5:160157143-160157165 TGGCAAACCCTGCCATGGCAGGG - Intergenic
1001878191 5:175218909-175218931 TGAGTATTCCTGCCCTGGTATGG - Intergenic
1002746566 6:62011-62033 TGGACATCCCTCCCCTGGGAAGG + Intergenic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1004517747 6:16335046-16335068 TAGGGGTCCCTGCCCTGGTTGGG + Intronic
1005498466 6:26409557-26409579 GGTGGATCGCCGCCCTGGCAGGG + Exonic
1006305361 6:33215288-33215310 AGGAGACCCCTGCCCAGGCAAGG + Intergenic
1007061877 6:38948036-38948058 AGGGGATTTCTGGCCTGGCATGG - Intronic
1007151844 6:39701275-39701297 CGGGAAGCCCTGCTCTGGCATGG + Intronic
1007702827 6:43774415-43774437 TGGGGTTCCCTGTCCTCTCAGGG + Intronic
1008351840 6:50500183-50500205 TTGGTATCCCTGCCCTCACATGG + Intergenic
1008424590 6:51342290-51342312 AGGAGCTCCTTGCCCTGGCAAGG - Intergenic
1016841880 6:148533369-148533391 TGGCAATCCCGGCCCTGTCATGG - Intronic
1018130900 6:160731807-160731829 TGGGCAGCCCAGTCCTGGCATGG - Exonic
1019270345 7:143627-143649 AGGGGGTCCCAGCCCTGCCAGGG + Intergenic
1019604643 7:1902370-1902392 TGGCTCTCCCTGCCCTGCCAAGG - Intronic
1019681143 7:2350325-2350347 TGGGGAAGCCTGACCTGGCTGGG - Intronic
1019709172 7:2510587-2510609 TGGGGATCCTGGGCCTGGCAGGG + Intergenic
1020079616 7:5280467-5280489 CGGGGATCCCTGCCTTGTCCTGG - Intronic
1021259273 7:18433326-18433348 TGGGCATCCCTGTCTTGGCTTGG - Intronic
1021415208 7:20376148-20376170 CATGGATCCCTGCCCTGACAGGG - Intronic
1022449827 7:30504523-30504545 TGGGCATCCCGGCCCCGGCGTGG + Intronic
1023622223 7:42085667-42085689 TGGGTTTCCCTGCCCTGGCAGGG - Intronic
1025730343 7:64102237-64102259 TGGGGGGCCCTGCCCTGCCCTGG + Intronic
1029105364 7:98170839-98170861 TGGGGAGCCCTGCAGTGTCATGG + Intronic
1031859005 7:126957458-126957480 TGGGCATCCCTGCTCTCTCAGGG + Intronic
1031974902 7:128087369-128087391 TGGGGTTGTCTACCCTGGCAAGG + Intronic
1032108661 7:129056246-129056268 TGGGGAGATCAGCCCTGGCATGG + Intergenic
1035253611 7:157612888-157612910 TGGGGGGCCCTGCCCTGGCCGGG - Intronic
1036791241 8:11721691-11721713 TCTGGAGCCCTGCCCTGGGAAGG + Intronic
1036800021 8:11783834-11783856 TGGAGCTTCCTGCCCTGGCCAGG + Intronic
1037813289 8:22098969-22098991 TGAGGCTTCCTTCCCTGGCAAGG + Exonic
1037908250 8:22728011-22728033 TGGGGCTCCCTGGCATGGCCTGG - Intronic
1037961759 8:23103115-23103137 TGGGGATCCGGGCCATGGTATGG - Exonic
1038014253 8:23499788-23499810 GGGGGATTCCTGCACTGGGAGGG + Intergenic
1038229761 8:25689083-25689105 TGGGGATCCCGGCCAGGGCCGGG + Intergenic
1038451528 8:27642530-27642552 TGGTGATTCCTGGCCAGGCATGG + Intronic
1040998980 8:53430989-53431011 TGGGGATCCCTCCACTGGCTGGG + Intergenic
1042624998 8:70748305-70748327 TGGGCATCCCTGCACTCGCAGGG + Intronic
1042856522 8:73273269-73273291 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1043278433 8:78431860-78431882 TGGGGATGCCCTCCCTGGTATGG - Intergenic
1046586485 8:116154851-116154873 TGAGGAGCCCTGCCATGCCAGGG - Intergenic
1047177557 8:122555846-122555868 TGGTGGTCCCTGCCTTGGGAAGG + Intergenic
1047204354 8:122791393-122791415 TTGGGAGCCCTGCCTGGGCACGG + Intronic
1049186780 8:141259381-141259403 TGGGCAGCACTGCCCAGGCATGG - Intronic
1049508677 8:143017293-143017315 GGGCCATCCCTGCCATGGCAGGG - Intergenic
1049746499 8:144265401-144265423 ACGGGCTCCCTCCCCTGGCAGGG + Intronic
1049755136 8:144308081-144308103 TGCAGCTCCCTTCCCTGGCAGGG + Intronic
1049781770 8:144432396-144432418 TGGGAGCCCCTGCCCTGGCCAGG - Exonic
1050941882 9:11471234-11471256 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1051669048 9:19492292-19492314 TTGTGATACCTGCCCAGGCAGGG + Intergenic
1053391920 9:37741923-37741945 TGGGGAGACTTGCCCTGGCCTGG - Intronic
1053422208 9:37986764-37986786 CGGGGATGCCCGCCCTGTCATGG - Intronic
1053489186 9:38487067-38487089 AGGAAAGCCCTGCCCTGGCATGG - Intergenic
1054713721 9:68537078-68537100 TGGCCTGCCCTGCCCTGGCATGG + Exonic
1055744329 9:79426587-79426609 TGGTGAGCCCACCCCTGGCAAGG - Intergenic
1056935805 9:90914133-90914155 TGGGGTACCCTGGCCTTGCAGGG - Intergenic
1056971348 9:91207286-91207308 TGGGAATCCCTGCCCTTGGGTGG + Intergenic
1059304254 9:113341379-113341401 AGGGGATCCCTTCCCTGGACTGG - Intergenic
1059525326 9:114986073-114986095 TGGGGCACCCTGCCCTGGCATGG + Intergenic
1060237811 9:121878489-121878511 TGGGAATCCATCCCCAGGCAGGG - Intronic
1060301263 9:122375847-122375869 TTGAGATCCCTGCTGTGGCAGGG + Intronic
1061127154 9:128684267-128684289 TGGGGCTCCCTTTCTTGGCAAGG + Intronic
1061139433 9:128755586-128755608 TGGGGATCCTTGTCCTGGAGTGG - Exonic
1062149065 9:135008080-135008102 TGGGGACCCAGACCCTGGCAGGG - Intergenic
1062187294 9:135224711-135224733 TGGGGAGCCCCTCCCTGTCAGGG + Intergenic
1062323320 9:136001090-136001112 GGGGGCTCCCTGCCCTGGTGGGG + Intergenic
1062681520 9:137784663-137784685 GGGGGAGCCAAGCCCTGGCAGGG + Intronic
1062715327 9:138007395-138007417 TGGTGAGCTCTGCCCTAGCAAGG + Intronic
1203736465 Un_GL000216v2:143455-143477 TGGGAATCTCGGCCCTGGCCCGG + Intergenic
1186737965 X:12486095-12486117 TGGGGCTCCCTGGCCTGGCAGGG - Intronic
1190108595 X:47575142-47575164 GCGGGATGCCTCCCCTGGCAGGG - Exonic
1190745298 X:53318948-53318970 TGGGCTTTCCTGCCCAGGCAGGG - Intronic
1191016254 X:55813395-55813417 TGGGTATCCCTGCACTCTCAGGG + Intergenic
1196044603 X:111244593-111244615 TGGAGATCCCTCCCCTGGTTAGG + Intergenic
1196483901 X:116181890-116181912 TGGGGCTCCCTGCCCTGTCCTGG - Intergenic
1199694680 X:150335472-150335494 TGGGGATCAATGCCCAGGCAGGG + Intergenic