ID: 949332995

View in Genome Browser
Species Human (GRCh38)
Location 3:2943055-2943077
Sequence GTATACACCTCATCTAGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949332995_949333000 7 Left 949332995 3:2943055-2943077 CCCAATCTAGATGAGGTGTATAC 0: 1
1: 0
2: 2
3: 4
4: 80
Right 949333000 3:2943085-2943107 TAGGGCAAAGAGAAACGTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 198
949332995_949332999 6 Left 949332995 3:2943055-2943077 CCCAATCTAGATGAGGTGTATAC 0: 1
1: 0
2: 2
3: 4
4: 80
Right 949332999 3:2943084-2943106 GTAGGGCAAAGAGAAACGTGAGG 0: 1
1: 0
2: 2
3: 13
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949332995 Original CRISPR GTATACACCTCATCTAGATT GGG (reversed) Intronic
902444141 1:16451130-16451152 TCATACACCTAATCTTGATTTGG + Intronic
906849503 1:49233139-49233161 ATATTTACCTCAACTAGATTTGG - Intronic
915882356 1:159685340-159685362 GTAATCACCTAATCTAGAGTTGG - Intergenic
923486518 1:234437360-234437382 GTAGACACCTCATCTGTATGGGG + Exonic
924889713 1:248261588-248261610 GTATACACCTAATATAGAGATGG - Intergenic
1072051744 10:91711334-91711356 GTATACCCACCATTTAGATTAGG - Intergenic
1072844139 10:98810163-98810185 GAAGACACCTGATCCAGATTTGG - Intronic
1075337992 10:121622464-121622486 ATACATACATCATCTAGATTGGG + Intergenic
1085731816 11:79006525-79006547 GTCTACACCTCATAGAGTTTTGG - Intronic
1088312391 11:108473804-108473826 GTATACAACTCAGATAGATTTGG + Exonic
1092495812 12:8993853-8993875 GTATATATCTACTCTAGATTTGG - Intronic
1093663895 12:21789659-21789681 ATCAACACCTCATCTACATTAGG + Intergenic
1095141191 12:38664795-38664817 GTATACATCACATTTAGCTTAGG + Intronic
1096825629 12:54275199-54275221 GTAAACACCCCTTTTAGATTTGG + Intronic
1100954355 12:99890291-99890313 GTATGAGCCTCATCTACATTAGG - Intronic
1101013510 12:100475525-100475547 GTTTCCACCTCTTCAAGATTGGG + Intronic
1105840913 13:24252987-24253009 GTATACACTTCTTCAAGATAGGG - Intronic
1106273496 13:28178874-28178896 GTATACAACTCAACGAGTTTGGG - Intronic
1107880087 13:44825175-44825197 GCAAGCACCTCCTCTAGATTAGG - Intergenic
1113407265 13:110053013-110053035 ATAAACACGTCATCTACATTAGG - Intergenic
1116918294 14:50546937-50546959 ATATACCCGTCATCTACATTAGG + Intronic
1117569593 14:57033564-57033586 GAAAACACATCATCTAGACTAGG + Intergenic
1121189424 14:92012518-92012540 GTAAACACCTAATCTAGATTAGG + Intronic
1134372867 16:13641668-13641690 GTAGACCACTGATCTAGATTAGG - Intergenic
1141898229 16:86972374-86972396 GTATAAACCTCAGCTTGGTTGGG + Intergenic
1143348701 17:6270761-6270783 GAATATACCCCATTTAGATTTGG + Intergenic
1150996162 17:70319976-70319998 TAATACATCTCATCTAGAATGGG - Intergenic
1157930596 18:51818023-51818045 GTATACAGCTCATTTCAATTAGG - Intergenic
1159082105 18:63746506-63746528 GTATACTCCTTTTATAGATTTGG - Intergenic
925961360 2:9019965-9019987 GTATACCCTTTATCCAGATTTGG + Intergenic
928561557 2:32493295-32493317 TTATACACCACAACTATATTAGG - Intronic
929434977 2:41921856-41921878 TCATACACGTAATCTAGATTGGG - Intergenic
933307213 2:80616683-80616705 GTATACAGCTAATCTACAGTTGG + Intronic
934105319 2:88690246-88690268 GTGACCACCTCATCTAAATTGGG - Intergenic
937213618 2:120295772-120295794 GTATAGAGCTGATTTAGATTGGG + Intergenic
940073930 2:149719778-149719800 GTCTCCACCTCATGTAGAATTGG - Intergenic
940586697 2:155661001-155661023 GTCCACACCTCATCTAAATTAGG + Intergenic
1173142638 20:40497676-40497698 GTAGACACCTGATATAGAGTTGG + Intergenic
1175283945 20:57824681-57824703 ATATACACAGCATCTAGGTTTGG + Intergenic
1177076755 21:16585015-16585037 GTAAACACCTCATATTTATTCGG + Intergenic
949332995 3:2943055-2943077 GTATACACCTCATCTAGATTGGG - Intronic
951517190 3:23573004-23573026 GTATTAATCTCATCAAGATTAGG + Intronic
959287299 3:104431765-104431787 GTATACACCTTCTTTACATTGGG + Intergenic
965352688 3:167633939-167633961 GTATACACTTAATATAGATAGGG + Intronic
968610164 4:1553427-1553449 GTATTCTCCTCGGCTAGATTAGG - Intergenic
970069178 4:12136973-12136995 GTATATACCTCATATATATAAGG - Intergenic
975638244 4:76472194-76472216 TCATACACCTCATGTGGATTGGG + Intronic
980538442 4:134160591-134160613 GGAGCCACCACATCTAGATTTGG - Intergenic
980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG + Intronic
988475624 5:31582618-31582640 GTATATGCCTCATGTATATTTGG + Intergenic
991135849 5:63180933-63180955 GTATGCACCCCATCTAGATGAGG + Intergenic
991135850 5:63180940-63180962 ATAGTCACCTCATCTAGATGGGG - Intergenic
991141500 5:63249293-63249315 TTATACTCCTCCTCTAGGTTAGG - Intergenic
992696495 5:79293844-79293866 GTATACTCCCCATCTAGATTTGG + Intronic
994567575 5:101471133-101471155 TTTTACACCTGATCGAGATTTGG + Intergenic
997683211 5:135770709-135770731 GTATACACCTCTTTGATATTTGG - Intergenic
1009302955 6:62050325-62050347 GTCAACACATCATCTACATTAGG - Intronic
1010237586 6:73588382-73588404 GGAGACACCACATCTAGATCAGG + Intergenic
1011185544 6:84671719-84671741 ATACACACCTCATGTTGATTAGG + Intergenic
1012355146 6:98305075-98305097 GTCTACACAACATCTTGATTTGG - Intergenic
1012650425 6:101745237-101745259 ATATAAACCTGATCTAGATTTGG + Intronic
1021426250 7:20502889-20502911 GTAAACAGATCATCTCGATTTGG - Intergenic
1023679596 7:42671941-42671963 GTAAAAACCTCATCTCAATTAGG + Intergenic
1027599218 7:80217987-80218009 GTATACATATAATCTAGATAAGG - Exonic
1032603144 7:133321370-133321392 ATAAACACATCATCTATATTAGG + Intronic
1036027227 8:4923003-4923025 GCATCCACCTCAGCTAGATGGGG + Intronic
1044024456 8:87151229-87151251 GTACGCACCCCATCTAAATTGGG - Intronic
1045037242 8:98185180-98185202 GTATACCGCTCATTAAGATTAGG + Intergenic
1046217897 8:111173486-111173508 GTCAACACATCATCTACATTAGG - Intergenic
1047326690 8:123845500-123845522 ATATACAACTCATCAAAATTTGG - Intergenic
1049294987 8:141828055-141828077 GTATTCACCTCTTGTAGAATGGG - Intergenic
1050129456 9:2396417-2396439 GCATAAACCTTCTCTAGATTGGG + Intergenic
1058544825 9:106050122-106050144 GAGTATAGCTCATCTAGATTGGG + Intergenic
1189518636 X:41742273-41742295 GTATAAACCTCATCTATTCTGGG + Intronic
1190344682 X:49326782-49326804 GTTTTCACCTCCTCTGGATTTGG - Exonic
1190345775 X:49336339-49336361 GTTTTCACCTCCTCTGGATTTGG - Exonic
1190346879 X:49345889-49345911 GTTTTCACCTCCTCTGGATTTGG - Exonic
1190348128 X:49536916-49536938 GTTTTCACCTCCTCTGGATTTGG - Exonic
1190349229 X:49546472-49546494 GTTTTCACCTCCTCTGGATTTGG - Exonic
1190350333 X:49556028-49556050 GTTTTCACCTCCTCTGGATTTGG - Exonic
1190351435 X:49565587-49565609 GTTTTCACCTCCTCTGGATTTGG - Exonic
1190352535 X:49575140-49575162 GTTTTCACCTCCTCTGGATTTGG - Exonic
1190353636 X:49584688-49584710 GTTTTCACCTCCTCTGGATTTGG - Exonic
1190354738 X:49594210-49594232 GTTTTCACCTCCTCTGGATTTGG - Exonic
1190355843 X:49603760-49603782 GTTTTCACCTCCTCTGGATTTGG - Exonic
1190365457 X:49689429-49689451 GTTTTCACCTCCTCTGGATTTGG + Exonic
1199487255 X:148361809-148361831 GTAAACACCTGTTTTAGATTGGG - Intergenic