ID: 949336195

View in Genome Browser
Species Human (GRCh38)
Location 3:2978264-2978286
Sequence ATTGAAGAGGGGATAGATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949336187_949336195 29 Left 949336187 3:2978212-2978234 CCTCCCACTGCATTGCTCTGTTC 0: 1
1: 0
2: 2
3: 22
4: 270
Right 949336195 3:2978264-2978286 ATTGAAGAGGGGATAGATCGTGG 0: 1
1: 0
2: 0
3: 4
4: 103
949336189_949336195 25 Left 949336189 3:2978216-2978238 CCACTGCATTGCTCTGTTCTCTC 0: 1
1: 0
2: 2
3: 71
4: 524
Right 949336195 3:2978264-2978286 ATTGAAGAGGGGATAGATCGTGG 0: 1
1: 0
2: 0
3: 4
4: 103
949336186_949336195 30 Left 949336186 3:2978211-2978233 CCCTCCCACTGCATTGCTCTGTT 0: 1
1: 0
2: 2
3: 24
4: 289
Right 949336195 3:2978264-2978286 ATTGAAGAGGGGATAGATCGTGG 0: 1
1: 0
2: 0
3: 4
4: 103
949336188_949336195 26 Left 949336188 3:2978215-2978237 CCCACTGCATTGCTCTGTTCTCT 0: 1
1: 0
2: 2
3: 36
4: 425
Right 949336195 3:2978264-2978286 ATTGAAGAGGGGATAGATCGTGG 0: 1
1: 0
2: 0
3: 4
4: 103
949336191_949336195 -1 Left 949336191 3:2978242-2978264 CCAGTATGTCTTGAGTGGAAACA 0: 1
1: 0
2: 1
3: 16
4: 156
Right 949336195 3:2978264-2978286 ATTGAAGAGGGGATAGATCGTGG 0: 1
1: 0
2: 0
3: 4
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949336195 Original CRISPR ATTGAAGAGGGGATAGATCG TGG Intronic