ID: 949339489

View in Genome Browser
Species Human (GRCh38)
Location 3:3013472-3013494
Sequence AACGGAGTCCTGCTTATTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949339483_949339489 26 Left 949339483 3:3013423-3013445 CCAGCAACTATTTCTGAGATGAG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 949339489 3:3013472-3013494 AACGGAGTCCTGCTTATTACTGG 0: 1
1: 0
2: 0
3: 1
4: 45
949339486_949339489 -4 Left 949339486 3:3013453-3013475 CCTGGGCTGATTTCCAGTGAACG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 949339489 3:3013472-3013494 AACGGAGTCCTGCTTATTACTGG 0: 1
1: 0
2: 0
3: 1
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949339489 Original CRISPR AACGGAGTCCTGCTTATTAC TGG Intronic
1065592805 10:27282832-27282854 AAGGGAGTCCTCATTATTTCTGG + Intergenic
1065657560 10:27967452-27967474 AAGGGAGTCCTCATTATTTCTGG - Intronic
1085936918 11:81157592-81157614 AATGCAGTCCTGATTATTGCAGG + Intergenic
1095423926 12:42054804-42054826 AATTTAGTCCTGCTTTTTACTGG + Intergenic
1097266370 12:57747674-57747696 AACTGGATCCTGCTTATTACAGG - Exonic
1099037747 12:77610634-77610656 AATGGAGTCCAGCTGATTCCAGG - Intergenic
1102650433 12:114438502-114438524 ACCGGTGTCCTGCTGATAACTGG + Intergenic
1110758708 13:79206416-79206438 AAAGGAACCCTGTTTATTACAGG - Intergenic
1117057017 14:51922758-51922780 AACGGACTCGTGCTTATAAAAGG + Intronic
1120354410 14:83412412-83412434 AAAGAAGGCATGCTTATTACGGG + Intergenic
1131994372 15:98120007-98120029 AATGGAGTCCTGATTGCTACAGG - Intergenic
1155986455 18:32235591-32235613 AATGGAGTCCTGTTTTTTCCAGG - Intronic
1156847720 18:41687903-41687925 AAGGAAGTTCTGCTTATTGCTGG + Intergenic
1157328359 18:46685503-46685525 AAGGGACTCCTGCATATTTCGGG - Intronic
925888157 2:8411316-8411338 AATGGAGTAGTGCTTAGTACAGG + Intergenic
929808060 2:45164633-45164655 AACGGAGGCCTTCTTGATACTGG - Intergenic
945002279 2:205364404-205364426 ATCTGAGTCCTCCTTGTTACAGG + Intronic
1168971642 20:1935311-1935333 AACCTAGCCCTGCTTATCACCGG + Intronic
949339489 3:3013472-3013494 AACGGAGTCCTGCTTATTACTGG + Intronic
959293992 3:104512437-104512459 AACTGAATCTTGCTTATAACTGG - Intergenic
963909915 3:150808004-150808026 AGAGGAGTCCTGCTTAGTGCTGG + Intergenic
966069952 3:175863603-175863625 GTTGGAGTCCTGGTTATTACAGG + Intergenic
967751022 3:193116568-193116590 AACCTAGTCCTCCTTATTATAGG + Intergenic
967844623 3:194033956-194033978 AATGAAGCCCTGCTTATTAAAGG + Intergenic
978679296 4:111359445-111359467 CACAGAGTCCTGCCTAATACAGG - Intergenic
986730536 5:10632061-10632083 AACTGAGTCCTGGCTATGACAGG - Intronic
988087682 5:26492821-26492843 GACAGAGTACTGCTTATCACTGG - Intergenic
988560157 5:32273686-32273708 GACGGAGTCCTTCTCATCACTGG - Intronic
996813336 5:127544642-127544664 CACGGAGTCCCGCTGATTGCTGG - Intronic
999834164 5:155351687-155351709 AATGAAGTCCAGCTTATTGCTGG - Intergenic
1001714140 5:173801124-173801146 AACGGTGTCCTGCTTATGCTAGG - Intergenic
1003445644 6:6181307-6181329 AACTGAGTCCTGCTCACTGCTGG + Intronic
1005067786 6:21835275-21835297 AAAGGAGTCCTGAATATTATGGG - Intergenic
1005403506 6:25460356-25460378 ATCAGAGTCTTGATTATTACTGG + Intronic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1014703146 6:124714555-124714577 GGCAGAGTCCTACTTATTACGGG + Intronic
1020816084 7:12907887-12907909 AGCTGAGTCTTGCTTATTCCTGG - Intergenic
1030933028 7:115548725-115548747 AAGGGAGACCTCCTTATTAGAGG - Intergenic
1038437043 8:27543602-27543624 AACAGACTCGTGGTTATTACTGG - Intronic
1042674692 8:71306825-71306847 AAGGGAGACTTGCTTAGTACTGG - Intronic
1043428761 8:80174087-80174109 ATCAGAGACCTGCTTCTTACTGG + Intronic
1046769513 8:118104240-118104262 GAGGGAATCCTGTTTATTACAGG + Intronic
1048332845 8:133482783-133482805 AAAGGAGTCATTCTTCTTACTGG - Intronic
1054805495 9:69392946-69392968 AATGGAGTACTGCTTCTTGCTGG + Intergenic
1187504178 X:19865401-19865423 AACAGAATCCTGCTTAATAGAGG + Intronic
1194958012 X:100203594-100203616 GAGGGAGTCCTGCTGCTTACTGG + Intergenic
1201417057 Y:13757752-13757774 ACTGGAGTCCTGCATATCACAGG + Intergenic