ID: 949341953

View in Genome Browser
Species Human (GRCh38)
Location 3:3039796-3039818
Sequence CCAGAGCTTGCTCTTTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949341953 Original CRISPR CCAGAGCTTGCTCTTTGATG GGG (reversed) Intronic
900981767 1:6049868-6049890 CCACAGCTGCCTCTTTCATGGGG - Intronic
901146903 1:7070987-7071009 TCTGAGCTTGCTCTTTGCAGGGG + Intronic
901324868 1:8360212-8360234 CCAGAGCCTCCTCCTTGATCTGG + Exonic
901602236 1:10431028-10431050 CCAGAGCTCGTCCTTAGATGTGG + Intronic
904183339 1:28682820-28682842 CAAGAGCTTCCTGTTTGGTGTGG + Intronic
906204143 1:43978413-43978435 ACAGAGCTTGCTCCTAGGTGGGG + Intergenic
907635728 1:56133040-56133062 CCAGTGTTAGCTCTTTGATGAGG - Intergenic
907713416 1:56905560-56905582 ACAGAGTTTGCTGTTTAATGGGG + Intronic
907921779 1:58920746-58920768 CCACAGCTTCCTATTAGATGAGG - Intergenic
910170391 1:84370914-84370936 TCAGAACTTGCTTTTTGATTAGG - Intronic
911433159 1:97819120-97819142 CCAGAGCAGGTTCTTTGATTTGG - Intronic
911511705 1:98815167-98815189 CCAGAGTTTGACCTTTGGTGTGG + Intergenic
912195418 1:107391905-107391927 CCTGAGATTCCTCTTTGATATGG - Intronic
912555421 1:110512655-110512677 CCGGAGCCTGCTCCTTGTTGGGG + Intergenic
915403244 1:155639695-155639717 GCAAAGCTTGATTTTTGATGAGG + Intergenic
915729648 1:158044014-158044036 ACCGAGCTTGTTCTTTTATGTGG - Intronic
916574746 1:166057337-166057359 CCAGAGCTTGCTTGTTCCTGGGG + Intergenic
918209014 1:182334374-182334396 CCTGAGGTTGCTCTTTGATTGGG - Intergenic
919422214 1:197384007-197384029 CCAGATTTTGCTCTTGGATATGG + Intronic
920203632 1:204275941-204275963 GCAGAGCCAGCTCTTTGCTGTGG - Intronic
920293742 1:204942968-204942990 CCAGTGCCTGCTCTCTGAGGGGG - Intronic
922702033 1:227766867-227766889 GCAGAGCGTGGTCTTTGAGGCGG - Intronic
1064365126 10:14700614-14700636 CCTGAGCTTGATCCATGATGTGG + Intronic
1068633154 10:59319212-59319234 CCACAGCTTTCTCTTTCATCTGG + Intronic
1069251947 10:66279040-66279062 CCTGAGGTTTCTCTTTGATATGG + Intronic
1070357992 10:75659072-75659094 ACAGACCTGGCTCTTTGCTGAGG + Intronic
1074368293 10:112877872-112877894 CCAGAACTGCCTCTTTGAAGAGG + Intergenic
1074454360 10:113584412-113584434 CCAGAGCTTGATCAATGAGGTGG - Intronic
1075208140 10:120464557-120464579 CCAGATCTTGCTGTCTGATGGGG + Intronic
1075651519 10:124130634-124130656 CCAGAGCCTCCTCTTTGCAGAGG + Intergenic
1080002214 11:27362957-27362979 CCAGAGCTTCCAGTTTGACGAGG - Exonic
1080941104 11:36919324-36919346 TGAGAGCTTGCTTGTTGATGAGG + Intergenic
1081286777 11:41280075-41280097 CCAGAGCTTACAGTCTGATGGGG - Intronic
1083037161 11:59649586-59649608 CTACAGCTTACTCCTTGATGTGG - Exonic
1083208870 11:61170238-61170260 CCTGAGCTTGCACTTTCACGGGG - Intergenic
1083269775 11:61566060-61566082 CCAGGTCTCGCTCTCTGATGAGG - Intronic
1083900546 11:65641284-65641306 GCAAAGCCTGCTCTTTGATTGGG + Exonic
1084980986 11:72828639-72828661 CCAGAGCTTCCTCTTTGTCGAGG - Intronic
1086876206 11:92098439-92098461 CCAGAGCTTGCCCTTAAAAGAGG + Intergenic
1087084454 11:94202472-94202494 CCAGAGCTTGGTATCTGTTGGGG - Intergenic
1088397153 11:109381701-109381723 CAAGAGCTGGCTGTTTGATAGGG - Intergenic
1089602962 11:119626476-119626498 GCAGAGCCCGGTCTTTGATGGGG + Intronic
1089924522 11:122243334-122243356 CTGGAGCTTTCTTTTTGATGGGG + Intergenic
1093992191 12:25602544-25602566 CCAGAGAAAGCTCTTTCATGTGG - Intronic
1095267942 12:40181703-40181725 CCGGTGTTTGTTCTTTGATGTGG + Intergenic
1097622615 12:61959288-61959310 GCATAGCATGCTCTTGGATGAGG - Intronic
1098197930 12:68021924-68021946 CCAGAGTTTGCACTTTGATGTGG - Intergenic
1099893348 12:88615790-88615812 ACATAGCTTGCTTTTTCATGTGG - Intergenic
1105322396 13:19340241-19340263 CAAGGGCTTGCTAGTTGATGTGG - Intergenic
1105875278 13:24546890-24546912 CAAGGGCTTGCTAGTTGATGTGG + Intergenic
1106788951 13:33135236-33135258 CCCAAACTTGCTCTTTAATGAGG + Intronic
1107161742 13:37238648-37238670 CTAGAGATTGCATTTTGATGAGG + Intergenic
1114261997 14:21043675-21043697 CCTGAGCTTGCTGTTTCTTGGGG - Exonic
1115779166 14:36750336-36750358 CCATAGCTTGGTAGTTGATGGGG - Intronic
1115905367 14:38197156-38197178 CCAGAGATTACTCTTTCATCTGG + Intergenic
1116119851 14:40708636-40708658 TCAGATCTTTCTTTTTGATGTGG - Intergenic
1119147734 14:72332124-72332146 CCAGAGCTTCCTCTTGGCTGGGG + Intronic
1120442799 14:84560764-84560786 GCAGAGCTTGATATTTGAGGGGG + Intergenic
1120591252 14:86375234-86375256 TCAGAGCTTGCTCTGTAAAGTGG + Intergenic
1122790668 14:104182954-104182976 CCAGAGCCTGCTTCTTGCTGGGG + Intergenic
1123167081 14:106335670-106335692 CCAGAGCTTGCTATATAGTGGGG - Intergenic
1123169698 14:106360381-106360403 CCAGAGCTTGCTATATAGTGGGG - Intergenic
1123202099 14:106675602-106675624 ACAGAGCTTGCTATATAATGGGG - Intergenic
1128532204 15:68462065-68462087 CCAGAGCCTGCACCTTGGTGTGG + Intergenic
1129537370 15:76324993-76325015 CCAGACCTTCCTCTTCCATGAGG + Intergenic
1129591600 15:76920086-76920108 CCAGAGCTTCCTGTAAGATGTGG - Intergenic
1131222553 15:90597145-90597167 CCAGGGCTTGCTCCTGGCTGGGG + Intronic
1131463726 15:92638039-92638061 CCAAAGTTCGTTCTTTGATGGGG - Intronic
1133104136 16:3495675-3495697 CCAGAGCTGTCTGTTTTATGTGG - Intergenic
1134913736 16:18051791-18051813 CCAGGACTTGCTGATTGATGGGG - Intergenic
1135379071 16:21978634-21978656 CCACAGATTGCTTTTTGATTTGG - Intronic
1136870415 16:33802605-33802627 CCAGAGCTTGCTATATAGTGGGG + Intergenic
1138321730 16:56119820-56119842 CCAGAGCTTGCTCTAGGCTGCGG - Intergenic
1139151788 16:64390547-64390569 TGAGAGCTTGATCTTTGAGGGGG + Intergenic
1139315583 16:66065290-66065312 GCTGAGCTTGCCCTTTGAGGAGG - Intergenic
1140699562 16:77568788-77568810 CAATAGCTTTCTTTTTGATGTGG + Intergenic
1203101758 16_KI270728v1_random:1313445-1313467 CCAGAGCTTGCTATATAGTGGGG - Intergenic
1143194080 17:5062095-5062117 CCAGAGGTAATTCTTTGATGTGG - Intergenic
1147310214 17:39591595-39591617 CCAGGGCCTGCCCTTTGCTGGGG + Intergenic
1148540782 17:48478775-48478797 CTAGAGCTTGCACTTTGGTTAGG - Intergenic
1151108716 17:71650092-71650114 CCAGAGCTTCCTCTTTGAGGGGG - Intergenic
1152120823 17:78417314-78417336 CCAGAGCTGGCTCTTCCATCAGG + Intronic
1152186136 17:78857394-78857416 CCAGAGCCTGGTCTTAGATCAGG + Intronic
1152909419 17:82990920-82990942 GCAGGGCTTGCTTTCTGATGTGG - Intronic
1153442703 18:5138373-5138395 CAAGTGCTTGCTCTTTGCTTAGG + Intergenic
1154020425 18:10659992-10660014 CCAGGGCTTGCTATTTGTTCAGG - Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1155895902 18:31325306-31325328 CCAGTGCTTGCTGTTTGTTTTGG - Intronic
1156327972 18:36091641-36091663 CCAGAGATCATTCTTTGATGTGG + Intergenic
1156519221 18:37707515-37707537 GCAGAGCTTGCTCCATGATGGGG - Intergenic
1157630223 18:49087941-49087963 CCTGTGCCTGCTTTTTGATGGGG + Intronic
1160973459 19:1780562-1780584 CCAGGGCTTGCTGCTTTATGGGG - Exonic
1165113544 19:33515391-33515413 CCAGAGCTTCCTCTGGGCTGGGG + Intronic
1165261371 19:34621972-34621994 GCAGAGCCTGATCTTTGAGGAGG + Intronic
1167274595 19:48529109-48529131 CCAGAGTTTGGTGTTTCATGTGG + Intergenic
925711207 2:6742666-6742688 CCAGTGCTTGCTCTATGGTCCGG - Intergenic
925853260 2:8104653-8104675 CCTGAGCTTGCTCTTTGCAAGGG - Intergenic
929085074 2:38159986-38160008 CCTGAGCATTCTCTTTGATACGG + Intergenic
930378068 2:50592563-50592585 ACAGAGCTTGCTCTTGGCTTAGG + Intronic
930958043 2:57227801-57227823 CCATTGCCTGCTTTTTGATGTGG - Intergenic
932465138 2:71916495-71916517 CCAGAGCTTTATGTTTTATGGGG - Intergenic
933483189 2:82883170-82883192 ACAGAGCTTGTTCTTTGCTTTGG - Intergenic
935782866 2:106523372-106523394 CCAGAGCTTGCTCTAGCAGGGGG + Intergenic
935877420 2:107525749-107525771 CCAAAGCTTGCTATTTCTTGGGG - Intergenic
936979381 2:118250111-118250133 CCAGAGATGACTCTTGGATGAGG - Intergenic
939409826 2:141810321-141810343 CCAGAGCTGGCTGTGTGATGGGG - Exonic
939548633 2:143585696-143585718 CCAAATCTTTCTCATTGATGAGG + Intronic
939712176 2:145536050-145536072 CCAAACTTTGCTCTTTGAAGAGG + Intergenic
940610684 2:155987611-155987633 CAAGACCTTGATCTCTGATGTGG - Intergenic
941021626 2:160412943-160412965 TCAAAGCTTACTCTTTTATGTGG - Intronic
942576498 2:177369031-177369053 CCTTAGCCTGCTTTTTGATGGGG + Intronic
944370826 2:198981664-198981686 TGAGATCTTTCTCTTTGATGTGG - Intergenic
945725113 2:213465584-213465606 GCAGAGCTTGATATTTGAGGAGG + Intronic
946874197 2:224111472-224111494 CCAGAGCTTGCTGACTGTTGGGG - Intergenic
948727647 2:239944762-239944784 ACAGAGCTTGCTCCTTGAGCTGG - Intronic
948771165 2:240251865-240251887 CCAGGGCTTGCTCCCAGATGGGG - Intergenic
1169180905 20:3565993-3566015 CAAGAGCATGCTTTTTGGTGTGG + Intronic
1169797179 20:9475824-9475846 CCAGACCTTGCCTTTTTATGAGG - Intronic
1170784210 20:19453431-19453453 CCTGATCTGGCTCTTTGATGAGG + Intronic
1171109127 20:22464376-22464398 CCAGAGCCTGCTCCTTGGGGTGG - Intergenic
1171504146 20:25619772-25619794 ACAGAGCTTGCGCTTAGATACGG + Intronic
1172709418 20:36909366-36909388 CCACAGCTGGTTCTTTAATGTGG - Intronic
1173575613 20:44111438-44111460 CAAGAGCCTGCCCTTTGAGGTGG - Intergenic
1174052532 20:47777071-47777093 ACAGAGCTTGCTTTTTAGTGAGG + Intronic
1174521470 20:51134081-51134103 GCAGAGCTTGCTCCTGGCTGGGG + Intergenic
1181559512 22:23692014-23692036 CCAGATCTGGAGCTTTGATGAGG + Exonic
1182555271 22:31125642-31125664 CCAGACCTTGCCCTTGGATGTGG + Exonic
1183192259 22:36329193-36329215 CCACACCCTGCTCTCTGATGTGG + Intronic
1183386136 22:37515864-37515886 CCATTGCTGGCTCTTTGACGTGG - Intronic
949341953 3:3039796-3039818 CCAGAGCTTGCTCTTTGATGGGG - Intronic
949823245 3:8138143-8138165 CCAGAAAGTGCTCTTTGAAGTGG + Intergenic
955502552 3:59599448-59599470 CCAAAGCTTTCTCATTGATTGGG + Intergenic
957625431 3:82648127-82648149 CCAGAGCTTGATATTTAAGGAGG - Intergenic
959490504 3:106982072-106982094 CCAGAGCTTTCTTCTTGATATGG - Intergenic
960961203 3:123071719-123071741 CCACACCTTGCTCTTTCCTGGGG - Intronic
963793903 3:149612242-149612264 CTCGAACTTGGTCTTTGATGTGG - Intronic
969445595 4:7243133-7243155 CCAGAGCTTGTGCGTGGATGGGG - Intronic
970848715 4:20575554-20575576 CCAAAGCATGCACTTTGAGGTGG + Intronic
971159698 4:24121210-24121232 CCAAAGCTGGCTCTCTGAAGGGG - Intergenic
973963078 4:56131397-56131419 CCAGAGATTGCTTTTTGGTCAGG + Intergenic
974950101 4:68576978-68577000 CCAGAGCCTACCCTTTGATATGG + Intronic
979975797 4:127194838-127194860 CCACAGCTTTCTCTTTTATATGG - Intergenic
980051430 4:128043905-128043927 CCAGAGATTTCTCTTAGCTGGGG + Intergenic
980639890 4:135564222-135564244 CCAGTGCTTGGTCATTGATATGG - Intergenic
980823691 4:138048473-138048495 CCCAAGCTTCCTCTTTGCTGTGG - Intergenic
981029666 4:140111763-140111785 ACAAAGTTTGCTCTTTGAGGTGG - Intronic
981752213 4:148103293-148103315 ACAGAGCTTGCAGTCTGATGGGG - Intronic
982823238 4:159970517-159970539 CCAGGGCTTGCTCTAGGTTGTGG + Intergenic
983511454 4:168613370-168613392 ACGGTGCATGCTCTTTGATGCGG - Intronic
983872925 4:172842956-172842978 GCAAGGCTTGCTCCTTGATGGGG + Intronic
984952092 4:185015606-185015628 CTAGAGCTTTCTCTGGGATGAGG + Intergenic
985583671 5:714728-714750 TGGGAGCTTGCTCTTTGCTGTGG + Intronic
985597180 5:799025-799047 TGGGAGCTTGCTCTTTGCTGTGG + Intronic
986653292 5:9986447-9986469 TGAGAGCTTGCTGTTTAATGTGG + Intergenic
987372653 5:17207509-17207531 CCAGAGCTCCTTCTTGGATGGGG - Intronic
989315490 5:40073173-40073195 CCAGGGCTTGATCTTGGATGAGG - Intergenic
991166300 5:63567834-63567856 GCAGAGCTTGATATTTGAAGAGG - Intergenic
991976455 5:72188013-72188035 CCAAAGCTTGCATTTTGAAGTGG - Intronic
993194470 5:84722982-84723004 GCAGAGCTTGGTCTTGGCTGTGG + Intergenic
993734614 5:91461739-91461761 TGAGATCTTTCTCTTTGATGTGG - Intergenic
995783445 5:115802485-115802507 CCAGAGCTTACTGTTTGCTTGGG - Intergenic
997338817 5:133126656-133126678 CCAGAGGGTGCTCTTTGAGGGGG + Intergenic
1000026237 5:157361577-157361599 CCAGAGCTTGCTCTATGAGGAGG - Exonic
1001278229 5:170366419-170366441 CCAGAGCTTGCTTGTCCATGGGG - Intronic
1002895887 6:1379885-1379907 CCAGAGCTCCCTCTTTGCAGTGG + Intergenic
1003373353 6:5550299-5550321 CCAGGTCTTGCTCTTTCATCAGG + Intronic
1007122957 6:39398880-39398902 CTAGAGGTTGCTTTTAGATGTGG + Intronic
1007398099 6:41588647-41588669 CCAGGGCGTGCTCTGTGTTGAGG - Exonic
1007997680 6:46325915-46325937 CCAGAGTTTCTTCTTTGAGGTGG + Intronic
1008630856 6:53361786-53361808 TCACAGGATGCTCTTTGATGGGG + Intergenic
1008922227 6:56854286-56854308 CCAGAGCCTAACCTTTGATGTGG + Intronic
1016086084 6:139916606-139916628 CAAGAGCTTGCTCTTTGGCTGGG + Intergenic
1016119489 6:140329137-140329159 GCAGAGCTTGATATTTGAGGAGG + Intergenic
1017549695 6:155493000-155493022 CCAGAGCTTGCTTGGTGATGTGG + Intergenic
1020649776 7:10860251-10860273 ACAGAGTTTCATCTTTGATGTGG - Intergenic
1020763372 7:12293362-12293384 GCAGAGCTTGATATTTGAGGAGG - Intergenic
1022197858 7:28086366-28086388 GCAGAGCTTCCTCTTTAATTTGG - Intronic
1022856380 7:34318896-34318918 CCTGGTCTTGCTCTTTCATGTGG + Intergenic
1022908869 7:34881138-34881160 CCTGAGGCTGCTCTTGGATGGGG - Intergenic
1032693752 7:134316016-134316038 CCCGAGAGTGCTCTTTGAGGTGG - Intronic
1032709196 7:134447726-134447748 CCAGCGCTTGTTCATTCATGTGG - Intronic
1035350086 7:158239375-158239397 CCGGAGCTTGTTCTTTCCTGGGG + Intronic
1038012844 8:23488337-23488359 CCAGGGCTTGCTCTTGGGTGTGG - Intergenic
1039404365 8:37299878-37299900 CCACAGCTTGACCTTGGATGGGG + Intergenic
1040569208 8:48592880-48592902 CCAGGGCTTGCTGTGAGATGTGG + Intergenic
1041256780 8:55985716-55985738 GCAGAGTTTACTCTTTGATGGGG - Intronic
1042533358 8:69835654-69835676 CCAGAGCCAGCTCTCTGGTGAGG - Intergenic
1045013642 8:97980395-97980417 CCACGGCCTCCTCTTTGATGAGG - Intronic
1047802611 8:128325712-128325734 CCTGAGATTACTCTTTGAAGAGG - Intergenic
1053448759 9:38174750-38174772 CCAGTGCTTGCTGTTTGGTATGG - Intergenic
1053653577 9:40193625-40193647 CCAGAGCTTTCTCTGCCATGGGG + Intergenic
1053903978 9:42822915-42822937 CCAGAGCTTTCTCTGCCATGGGG + Intergenic
1054531009 9:66182599-66182621 CCAGAGCTTTCTCTGCCATGGGG - Intergenic
1054745760 9:68852576-68852598 CCAGAGGGAGCCCTTTGATGTGG + Intronic
1054807908 9:69411119-69411141 GCAGAACTTGCTCTCTGATTGGG + Intergenic
1056598516 9:88027367-88027389 TCCTAGCTTGCTCTTTTATGTGG + Intergenic
1056725475 9:89110951-89110973 TTACAGTTTGCTCTTTGATGAGG - Intronic
1057973505 9:99579708-99579730 TCAGAGAAGGCTCTTTGATGAGG + Intergenic
1060009069 9:120027420-120027442 CCAGAGCTACCTCCTTGATGGGG - Intergenic
1060794408 9:126504443-126504465 CAAGAGTTGGCTCTTGGATGTGG + Exonic
1190685612 X:52870160-52870182 CCAGAGCTTGCTATCTGGTTAGG - Intergenic
1195392561 X:104378148-104378170 CCAGAGCTAGCTCTCCTATGTGG - Intergenic
1196405970 X:115362823-115362845 CCAGTGCTTGTTCATTTATGTGG - Intergenic
1201396751 Y:13556648-13556670 GCAGAGCTTGATATTTGAGGAGG - Intergenic