ID: 949344491

View in Genome Browser
Species Human (GRCh38)
Location 3:3064244-3064266
Sequence ATTCTATCCTGGGGGATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949344491_949344496 16 Left 949344491 3:3064244-3064266 CCATTGATCCCCCAGGATAGAAT 0: 1
1: 0
2: 2
3: 11
4: 114
Right 949344496 3:3064283-3064305 ACATGATTATTTTCCCAAATTGG 0: 1
1: 0
2: 2
3: 32
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949344491 Original CRISPR ATTCTATCCTGGGGGATCAA TGG (reversed) Intergenic
901531072 1:9852847-9852869 ATTCCCTCCTGGGGCATCCAGGG - Intronic
902084039 1:13843572-13843594 ATTTTTTCCTGTGGGATCAGTGG + Intergenic
902103225 1:14011147-14011169 ATTCCATCCTGGGACACCAAGGG - Intergenic
902837395 1:19055627-19055649 GTTCTATCCTTGGGGATCTCAGG + Intergenic
904059125 1:27694313-27694335 ACTCTAGCCTGGGGGACAAAAGG - Intergenic
909154469 1:72054910-72054932 TAATTATCCTGGGGGATCAAAGG + Intronic
920535150 1:206732317-206732339 CTCCTATCCTGCGGGATCACTGG + Intronic
921296539 1:213709368-213709390 TTTGTATTCTGTGGGATCAATGG + Intergenic
924395502 1:243615543-243615565 ATTTTATTCAGGGGGATGAAAGG + Intronic
1064308810 10:14193067-14193089 ATTCTACCCTGGGCCATCCATGG + Intronic
1065821945 10:29533704-29533726 ATGCTATCCTGGGGGAGAATGGG + Intronic
1067139821 10:43648080-43648102 ATCATATCCTGGGGGAGCCACGG - Intronic
1067975357 10:51018629-51018651 ATTCTGTCCTGAGTGATTAATGG - Intronic
1068565719 10:58572821-58572843 ATTCCATGTTGAGGGATCAAAGG - Intronic
1069502409 10:68965870-68965892 TTTCTTTCCTTGGGGCTCAAGGG + Intronic
1069543275 10:69311615-69311637 ATTGTATCCTGGAGGAGGAAGGG - Intronic
1070537592 10:77391260-77391282 ATCCTTCCCTGGGGCATCAAGGG - Intronic
1072702723 10:97655603-97655625 ATTCTATCCTGGGTGACAGAGGG - Intronic
1075106038 10:119540689-119540711 ATTGTATCCTGGGAGATACATGG - Intronic
1077603649 11:3592180-3592202 CTTCTATCATGGGGGAGCAGGGG - Intergenic
1080322202 11:31023404-31023426 ATTCCATCCTGGGCAATCAAAGG + Intronic
1080446758 11:32344804-32344826 GTTCTTTCCTGGGGGATGAAGGG - Intergenic
1080613458 11:33925458-33925480 ATGCTAGCCTGGGGGAAAAAAGG - Intergenic
1084970952 11:72771791-72771813 CTTCTATCCTGGGGGGGCGAGGG + Intronic
1092072896 12:5647545-5647567 ATTCTAGCATGGGTGGTCAATGG + Intronic
1092657609 12:10703522-10703544 ATTCTATAGTTGGGGATTAAAGG - Intronic
1094098247 12:26732350-26732372 ATACTATCCTGAAGGATCTAGGG - Intronic
1095392925 12:41729890-41729912 TTTTTTTCCTGGGGGAACAATGG - Intergenic
1098909586 12:76195411-76195433 GTTCTATCCCTGCGGATCAAGGG + Intergenic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1106606055 13:31230368-31230390 GTTCTTTCCTGGGAGAACAAAGG - Intronic
1111854415 13:93619483-93619505 ACTCTATCCTGGGTGACAAAGGG - Intronic
1112322234 13:98418305-98418327 ATTCTATCCTGGGTGACAGAGGG - Intronic
1112566981 13:100560330-100560352 GTCAGATCCTGGGGGATCAAAGG - Intronic
1112841561 13:103585395-103585417 ATTCTTTCCTGGTGGCTCTAGGG - Intergenic
1114631481 14:24162129-24162151 ATGCCATCCTGGGGGATAATAGG - Exonic
1115190198 14:30739634-30739656 CTTCTATCCTTGGAGATCAAAGG + Intergenic
1120050246 14:79857594-79857616 ATAGTGTCCTGGGGGATCAAAGG - Intronic
1120434429 14:84462941-84462963 ATTCTACCCTGGGTGACAAAGGG - Intergenic
1124184074 15:27506564-27506586 ATTCTTTTCTGGGGGCTCTAGGG - Intronic
1125588510 15:40839452-40839474 ATTCTATACTGTGGGCCCAAGGG - Intergenic
1126773614 15:52081003-52081025 ATTCTAGTCTGGGGCAGCAAAGG + Intergenic
1126819391 15:52487087-52487109 ATTATTTCCTGGGGGATGTATGG + Intronic
1126838945 15:52696880-52696902 ATTATATTCTGGGGGATTCATGG + Intronic
1127908146 15:63392487-63392509 ATGCTGTCCTGGGGGATCTAAGG + Intergenic
1128370886 15:67038397-67038419 AGTCTATCCTGGGGAAGGAAAGG - Intergenic
1134441342 16:14301487-14301509 TTTCAACCCTGGGGGATCCAGGG + Intergenic
1138024115 16:53509496-53509518 ACTCTATCCTGGAGGACAAAGGG - Intergenic
1138936285 16:61728426-61728448 ATACTATCCTGAGGGATTAATGG + Intronic
1144016833 17:11204193-11204215 ACTCTAGCCTGGGGGACAAAAGG + Intergenic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1155563862 18:27110989-27111011 ATTCTATCCAGGACGATCAGTGG - Intronic
1157716054 18:49888167-49888189 ATTCTTTCTTGGGGGAGTAAGGG + Intronic
1162233397 19:9285366-9285388 ATGCTACCCTGGGGGATCCCAGG + Intergenic
1163170248 19:15526130-15526152 ATTCTAGCCTGGGTGACCTAGGG + Intronic
925581746 2:5417915-5417937 ACTCTATCCTGGGAGAGCCATGG - Intergenic
925953124 2:8934752-8934774 ATTCTCTCTTGTGGGATCATGGG + Intronic
926078873 2:9967223-9967245 TGACTCTCCTGGGGGATCAAGGG - Intronic
926865555 2:17353736-17353758 ATTCTATACTGGGAGATCTTTGG - Intergenic
927387075 2:22547223-22547245 TTTCTATTCTAGGGGCTCAAAGG + Intergenic
933594911 2:84273788-84273810 GTTCTAGGCTGGGGGATAAATGG - Intergenic
933714173 2:85348216-85348238 ATACTATCCTGTGGAATCCAAGG + Intronic
938993445 2:136653292-136653314 ATTCTATTCTGTGTGATGAAGGG + Intergenic
939142792 2:138376143-138376165 ATTCTATTTTGGGGAAACAATGG - Intergenic
939829055 2:147050798-147050820 ATTCCAACCTGGGTGATGAAGGG - Intergenic
1169311096 20:4540714-4540736 ATTCTATCCTGGGAGAACAGGGG - Intergenic
1172886643 20:38235637-38235659 ATTCTTTCCTGGAGGCTCTAAGG - Intronic
1174877086 20:54238585-54238607 ATTGTATCTTTGGAGATCAAAGG + Intergenic
1175805581 20:61826736-61826758 ATGCTATCCTAGGCCATCAACGG - Intronic
1179116133 21:38494208-38494230 CCTCTATCCTGTGGGGTCAAAGG + Intronic
1180500183 22:15923285-15923307 ATTCCATCCTGCGGGATCCCAGG - Intergenic
1181410768 22:22717170-22717192 ATTCTTTCCTGGGGCGTCATAGG + Intergenic
1181687615 22:24540518-24540540 ATTCTAGCCACGGGGATGAAAGG - Intronic
1182579026 22:31292717-31292739 ATTCTATCAAGGGGCATCATGGG + Intergenic
1182792511 22:32964797-32964819 GTTCTGTCATGGGGCATCAAGGG - Intronic
949208453 3:1469049-1469071 ATTCTTTCCTGTTAGATCAATGG + Intergenic
949344491 3:3064244-3064266 ATTCTATCCTGGGGGATCAATGG - Intergenic
952017000 3:28970211-28970233 ATACCATCCTGGGGGCACAAAGG - Intergenic
954466178 3:50656338-50656360 ATTCTGTCCTGGGTGGTCAGTGG - Intergenic
956939146 3:74136625-74136647 CTTCTATCCTGGAGGATCCCAGG + Intergenic
958659150 3:97043088-97043110 TTTCTTTCCTGGGGGAAAAAAGG - Intronic
958712204 3:97731033-97731055 ATTGTATCGTGGGGGATGATTGG + Intronic
959767215 3:110046160-110046182 ACTCTAGCCTGGGTGATAAAGGG - Intergenic
962881299 3:139579176-139579198 ATTCTCTCATGGGGGAGAAAGGG + Intronic
963294581 3:143531919-143531941 ATTCTATCCTGAGGATACAATGG + Intronic
964539793 3:157767319-157767341 ATTCTATATTAGGGGATCAGGGG + Intergenic
967997002 3:195174369-195174391 ACTCTAGCCTGGGTGACCAAGGG - Intronic
974245323 4:59307831-59307853 ATTGTCTCTTGGGGAATCAAAGG - Intergenic
975102158 4:70525865-70525887 ACTCCATCCTGGGTGATGAAGGG + Intronic
977823481 4:101502932-101502954 ATTCTTTCTTGGGGGTTCAGGGG + Intronic
982004826 4:151053549-151053571 ATTCCAGCCTGGGAGACCAAGGG + Intergenic
982019012 4:151185120-151185142 GATCTATCTTGGGGGATCCATGG + Intronic
983110394 4:163742507-163742529 ATTCTAGCCTGGGTGATGGAAGG - Intronic
983611374 4:169648992-169649014 ATTCCAGCCTGGGTGATAAAGGG + Intronic
988246784 5:28695077-28695099 ACTCCAGCCTGGGGGATGAAAGG - Intergenic
990938240 5:61173358-61173380 ATTGTATCCTGGGGGAATGACGG + Intergenic
994257279 5:97613767-97613789 ATTCCTTCCTGGGGGATCAGCGG + Intergenic
997533113 5:134594804-134594826 AGACTATCCTGGGGGATCACTGG + Intergenic
997572446 5:134941421-134941443 ATTCTATACTTGGGGATTTATGG - Intronic
1001702846 5:173720237-173720259 ATTTTATCTTGTGTGATCAAGGG + Intergenic
1002375672 5:178787424-178787446 GTTTTATCTTGGGGGACCAAAGG + Intergenic
1008179030 6:48304924-48304946 ATTGAATCCTGGGGGCTCCATGG - Intergenic
1008303434 6:49871068-49871090 ACTCTAGCCTGGGGGATAAGAGG + Intronic
1008520317 6:52356790-52356812 ATTTTATCCTGGGGGAGAGAGGG - Intergenic
1014028239 6:116673012-116673034 ACCCTATCCTGGGGGTTCAAAGG + Intergenic
1021416463 7:20392101-20392123 GTTCTATGCTGGGGGGTCCATGG - Intronic
1031884250 7:127229554-127229576 ATTCTATCCAGTGGTTTCAAAGG + Intronic
1034094645 7:148395931-148395953 AATCTATCGTAGGGGATGAAGGG - Intronic
1036968668 8:13329412-13329434 ATTCTGGCCTGTGGGATAAATGG + Intronic
1040437772 8:47409518-47409540 AGTCTTTCCTGAGGGATCATTGG + Intronic
1044428791 8:92084669-92084691 ATTCTATCTTTGGGGAGGAAGGG + Intronic
1045776146 8:105805499-105805521 ATGAGATCCTTGGGGATCAATGG + Intergenic
1045799317 8:106083500-106083522 ATACTTTCCTGGGGGCTTAATGG - Intergenic
1047403539 8:124566064-124566086 ATTCTAGCCTTGGGTATAAATGG - Intronic
1047778221 8:128091032-128091054 AGACTTTCCTGGGGGATTAAAGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1052400921 9:27998756-27998778 ATTCCATCCTGGGTGATAGAGGG + Intronic
1053239058 9:36481690-36481712 ATGCTGTTCTGGGGGCTCAAGGG - Intronic
1053460967 9:38271365-38271387 ACTCTAGCCTGGGGGATAGAGGG - Intergenic
1056276080 9:84995542-84995564 ATTCTGGCCTGGGGGATGAGAGG + Intronic
1187813801 X:23209321-23209343 AATCTAACCTTGGGGATTAAGGG - Intergenic
1188601820 X:31976050-31976072 ATTCTCTGCTGGAGGATGAATGG + Intronic
1188684000 X:33046569-33046591 ATGTTATCCTGGGCAATCAATGG - Intronic
1192281232 X:69688431-69688453 ACTCCAGCCTGGGCGATCAAGGG - Intronic
1194205810 X:91009748-91009770 ATTCCAGCCTGGAGGATCCATGG - Intergenic
1195156414 X:102127433-102127455 CTTCTATCCTAGGGGTCCAAGGG + Exonic
1200385089 X:155882123-155882145 ACTGTATCCTCTGGGATCAAGGG - Intronic
1200551568 Y:4584559-4584581 ATTCCAGCCTGGAGGATCCATGG - Intergenic