ID: 949347352

View in Genome Browser
Species Human (GRCh38)
Location 3:3089082-3089104
Sequence CCTAGGGAGGAGGGGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3130
Summary {0: 1, 1: 2, 2: 17, 3: 211, 4: 2899}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949347336_949347352 18 Left 949347336 3:3089041-3089063 CCTGTGTGTGCTGGGTCAGTTTA 0: 1
1: 0
2: 0
3: 13
4: 126
Right 949347352 3:3089082-3089104 CCTAGGGAGGAGGGGAGGGAGGG 0: 1
1: 2
2: 17
3: 211
4: 2899

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949347352 Original CRISPR CCTAGGGAGGAGGGGAGGGA GGG Intronic
Too many off-targets to display for this crispr