ID: 949349458

View in Genome Browser
Species Human (GRCh38)
Location 3:3110763-3110785
Sequence ATCAAACAGAAATGGAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 659
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 605}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949349458_949349463 -2 Left 949349458 3:3110763-3110785 CCTTTGTTCCATTTCTGTTTGAT 0: 1
1: 0
2: 4
3: 49
4: 605
Right 949349463 3:3110784-3110806 ATTCCTTCTGGGGAATTTCGAGG 0: 1
1: 0
2: 0
3: 11
4: 205
949349458_949349465 1 Left 949349458 3:3110763-3110785 CCTTTGTTCCATTTCTGTTTGAT 0: 1
1: 0
2: 4
3: 49
4: 605
Right 949349465 3:3110787-3110809 CCTTCTGGGGAATTTCGAGGTGG 0: 1
1: 0
2: 1
3: 3
4: 115
949349458_949349466 18 Left 949349458 3:3110763-3110785 CCTTTGTTCCATTTCTGTTTGAT 0: 1
1: 0
2: 4
3: 49
4: 605
Right 949349466 3:3110804-3110826 AGGTGGCTAGCTAGCAAAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949349458 Original CRISPR ATCAAACAGAAATGGAACAA AGG (reversed) Intronic
900050146 1:589777-589799 ATCAAATAAAAATGGATTAAAGG + Intergenic
901131386 1:6963858-6963880 AGGAAACTGAAGTGGAACAAGGG - Intronic
902030311 1:13417227-13417249 ATAGGACAGAAATGGAACATGGG - Intronic
902598170 1:17523052-17523074 ATAAAAAGAAAATGGAACAATGG - Intergenic
903103841 1:21056519-21056541 ATCCCAAAGAAATGGCACAAAGG + Intronic
904103787 1:28058800-28058822 TTCAAACAAAAAAGGAAAAATGG + Intronic
905358747 1:37403651-37403673 ATGAAACAGTAAGGGCACAAAGG + Intergenic
907838403 1:58133078-58133100 AAGAATCAGAAATGGAAGAAGGG - Intronic
908059311 1:60329910-60329932 AGCTAAAAGAAATGGAAAAAAGG + Intergenic
908398198 1:63745625-63745647 TGCAAACACAAAAGGAACAAAGG - Intergenic
908646994 1:66289052-66289074 ATAAAATAGAAATGGAAGACTGG + Intronic
908658865 1:66417224-66417246 ATATGACAGAAATGGAACATGGG - Intergenic
908848394 1:68348455-68348477 ATAGGACAGAAATGGAACATGGG + Intergenic
909534844 1:76725039-76725061 GTCAAACACAAATGGAAGCAAGG + Intergenic
909762507 1:79309414-79309436 ATGAAACAAAAAAGGAACTAGGG + Intergenic
910240721 1:85083064-85083086 ACCAAACAGGAATGGAAGATTGG - Intronic
911057397 1:93720641-93720663 AACAAACACACAAGGAACAAAGG - Intronic
911468622 1:98286735-98286757 ATCCAACAGACATGAAAAAATGG + Intergenic
911589167 1:99726705-99726727 CTCAAAAAGAAAAGGAACATGGG - Intronic
911640311 1:100281506-100281528 ATCACACAGATACGCAACAATGG - Intronic
912628972 1:111230048-111230070 CTCAAAAAGAACTAGAACAAGGG - Intronic
913167486 1:116201449-116201471 ATGAAGCAGAAATGGAAGAAAGG - Intergenic
913382304 1:118225826-118225848 ATAGGACAGAAATGGAACACGGG + Intergenic
913437585 1:118863289-118863311 CTCAATCACAGATGGAACAATGG + Intergenic
913711971 1:121493907-121493929 ATCATACTGACATGGAAGAAAGG - Intergenic
915251135 1:154589475-154589497 TTAAAACAGAAATAGAATAATGG + Intronic
916365709 1:164025166-164025188 ATAGGACAGAAATGGAACATGGG - Intergenic
916617922 1:166462638-166462660 AGCAGACAGAAAAGCAACAAAGG - Intergenic
916723209 1:167500971-167500993 TTCAAACAGAGATGGAAAACTGG + Intronic
917377766 1:174367907-174367929 ATCAAACTGAATTGAAAGAAAGG - Intronic
917615205 1:176735777-176735799 AACAAAGAGAAAATGAACAAAGG - Intronic
918323900 1:183391466-183391488 ATCCAAAAGATATGGAAGAACGG - Intronic
918434638 1:184498943-184498965 ATCATAAAGAAAAGGAACTAAGG - Intronic
918791074 1:188829878-188829900 AACAAACAGAAAATAAACAAAGG + Intergenic
919010918 1:191962146-191962168 ATTACAATGAAATGGAACAATGG - Intergenic
920296942 1:204963786-204963808 ATCAAAGGGAAATGGAAGGAAGG + Intronic
921442023 1:215198989-215199011 AAAAAACAGAAATGGAATAAGGG - Intronic
921876612 1:220203573-220203595 AACAAACAGAAATTCAAAAATGG + Intronic
921890372 1:220347512-220347534 AACAAACAGGTATGGAAAAAAGG - Intergenic
922392674 1:225162155-225162177 ATCAAATAAAAATGGATTAAAGG - Intronic
922660786 1:227428889-227428911 ATCGCACAGAAATAGAAGAAGGG - Intergenic
923822938 1:237466490-237466512 ATCAAAAAGAAAAGGAAAAAAGG - Intronic
924018311 1:239752320-239752342 CTCTGACAGAAATAGAACAATGG - Intronic
924273647 1:242362369-242362391 ATCAAAAAGAAAATGAAAAAGGG - Intronic
924319291 1:242831236-242831258 ATAAACCAGAAAGGCAACAAGGG - Intergenic
1062838692 10:652797-652819 TTTAAACAGAAATGGCACCAGGG + Intronic
1062970984 10:1649141-1649163 ACCAAACATAAATGGAAAGATGG - Intronic
1064279412 10:13937679-13937701 ATAAAACTGAAATGAAAAAAAGG + Intronic
1064581895 10:16802218-16802240 TACAAACAGAAATGAAAGAAGGG + Intronic
1065107152 10:22401210-22401232 ATCATATAGAAATGGTTCAAGGG - Exonic
1065749499 10:28872686-28872708 ATAAAATAAAAATCGAACAATGG + Intronic
1066711064 10:38234285-38234307 ATCAAAAAGAAAATGAAAAAGGG + Intergenic
1067687685 10:48476974-48476996 ATAAAAAATAAATGAAACAAAGG - Intronic
1068089427 10:52414326-52414348 AACAACCAGATGTGGAACAATGG - Intergenic
1068170539 10:53387605-53387627 AACACAAAGAAATGGAACAGAGG - Intergenic
1068348263 10:55812523-55812545 ATCAGTCAGAAACAGAACAATGG - Intergenic
1068686379 10:59874223-59874245 CTCTAACAGGAATGTAACAAAGG + Intronic
1068798625 10:61113897-61113919 ATCAAACAGCATTGAAATAAAGG - Intergenic
1068879814 10:62036305-62036327 ATCAAGAAGAAATGGACCACAGG - Intronic
1069426731 10:68294970-68294992 AGCAAACGGAAATGGAAACAAGG - Intronic
1069758942 10:70794501-70794523 ATGACAAAGAAAAGGAACAACGG - Intergenic
1070573453 10:77659226-77659248 CTCAATCACAGATGGAACAATGG + Intergenic
1070821401 10:79357429-79357451 ATAGGACAGAAATGGAACATGGG + Intergenic
1070941625 10:80353475-80353497 TTAAAACAGAAAAGGAAAAATGG + Intronic
1071251786 10:83826347-83826369 GTCATACAGAATTGGAAGAATGG + Intergenic
1071357855 10:84816469-84816491 AACAAACAGAAATGACAAAAGGG - Intergenic
1071369058 10:84932670-84932692 AACAAACAGAAACAAAACAAAGG - Intergenic
1071380087 10:85050433-85050455 ATCAAAAAGAAATGGAAACCAGG + Intergenic
1071758412 10:88572268-88572290 ATCAAAAAGAAATTAAACAAAGG + Intronic
1072468752 10:95692598-95692620 AAAAAAAAGAAATGGAAAAAAGG + Intronic
1073185898 10:101614868-101614890 AACAAACAGAAATGGCACCGTGG + Intronic
1073502370 10:103952055-103952077 ATCAAACCATAATGGAACATAGG + Intergenic
1073798262 10:107012638-107012660 AACAATCAGAATTGGAACTAAGG + Intronic
1073823054 10:107287413-107287435 ATCAAATACAAATGCAATAAAGG - Intergenic
1073841997 10:107508377-107508399 ATCAATGAGAAATAGAGCAAGGG - Intergenic
1074522013 10:114234593-114234615 ATCAAGTAAACATGGAACAAAGG - Intergenic
1075616187 10:123892071-123892093 GTAAAACAGGAATGGAACAGCGG - Intronic
1075958373 10:126545137-126545159 ACGAAACAGAGATCGAACAAGGG - Intronic
1076025840 10:127112440-127112462 ATGAAACAGAAATGGGGCATAGG - Intronic
1076457972 10:130616136-130616158 ATGAAACAGAAAAGAAAAAAAGG - Intergenic
1077876080 11:6307518-6307540 ATGAAACAGAAATGAAAGAATGG + Intergenic
1078114975 11:8438415-8438437 ATTAAATAGAAATGAATCAAAGG + Intronic
1078627211 11:12968552-12968574 TTAAAACAGAAATGGGAGAAGGG + Intergenic
1078728496 11:13954629-13954651 AGCAAACAGAACTGGAAATAGGG - Intergenic
1079049498 11:17141026-17141048 ATCAACCAGAAAAAAAACAAAGG + Intronic
1079838206 11:25362418-25362440 TTTAAACAGAAAGGAAACAATGG + Intergenic
1080393354 11:31868294-31868316 AAAAAAAAGAAATGGAAAAATGG - Intronic
1081744996 11:45466755-45466777 CTCAAACAGACTTGGAACAGGGG - Intergenic
1082129371 11:48470208-48470230 ATCAAACAGAAATTCAAGAGAGG - Intergenic
1082247718 11:49943493-49943515 ATCAAACAGAAATTCAAGAGAGG + Intergenic
1082562904 11:54641102-54641124 ATCAAACAGAAATTCAAGAGAGG - Intergenic
1085234603 11:75004488-75004510 ATCCAACAGAAATGGGCAAAGGG - Intronic
1085571571 11:77562736-77562758 ACCAAACAAAAATGGACAAATGG - Intronic
1085615286 11:77993371-77993393 AACAAAAAGAAAGGGAAGAATGG + Intronic
1085878445 11:80437376-80437398 AACAAAAAAAAATGGAACATAGG - Intergenic
1085898846 11:80672700-80672722 ATCAAATCGAAATGGATTAAAGG - Intergenic
1085999953 11:81971263-81971285 ATAAAAGAGAAATGAAATAAGGG - Intergenic
1086128244 11:83372068-83372090 ATCACACAGAAATTGTAGAATGG - Intergenic
1086506474 11:87509753-87509775 ATAAAAAAGAAAAGGAAGAAGGG - Intergenic
1087092765 11:94291613-94291635 ATAAAAAAGAAATGAAATAATGG + Intergenic
1087168092 11:95024188-95024210 ATCAGACACCAATGGAACATGGG + Intergenic
1087965642 11:104410734-104410756 ATAGGACAGAAATGGAACATGGG - Intergenic
1088036903 11:105328426-105328448 ATCAAATGGAAATGGTATAAAGG + Intergenic
1089662056 11:119992175-119992197 ATCAGACAGAAATGCTAGAAAGG + Intergenic
1090445681 11:126762941-126762963 ACCAAAGGGAAATGAAACAAAGG - Intronic
1090529812 11:127578824-127578846 ATCATACCTCAATGGAACAAAGG + Intergenic
1090867041 11:130710265-130710287 ATTTAACAGGAATGGCACAAAGG - Intronic
1090991388 11:131819986-131820008 GTCACTCAAAAATGGAACAAAGG - Intronic
1093060909 12:14602460-14602482 ATAAAACAGAAATGGCCCATGGG - Intergenic
1093642790 12:21546904-21546926 ATTCAACTGAAATGGAACTAAGG + Intronic
1093860568 12:24161358-24161380 ATCAAGCAGAAATGTCACATAGG + Intergenic
1093902850 12:24655548-24655570 ATCAAACCAAAATAGATCAAAGG - Intergenic
1094346668 12:29477402-29477424 ATCAGAAACAAATGGAACCATGG + Exonic
1094630820 12:32172071-32172093 AGCAAACAGAAAAGGAACGGAGG - Intronic
1095506422 12:42903965-42903987 TTCAACCAGAAATGGAAAAAAGG - Intergenic
1095809727 12:46359333-46359355 AACAGACAAAAATGGACCAACGG + Exonic
1095999268 12:48115150-48115172 ATCAGACACCAATGGAACATGGG + Intronic
1097179868 12:57165719-57165741 AACAAACAAAAATGGTGCAAAGG + Intronic
1097692979 12:62751231-62751253 ATCAGACACAAATCAAACAAGGG - Intronic
1098341356 12:69454844-69454866 ATCAAAAAGACAGGGAATAATGG - Intergenic
1098491626 12:71087786-71087808 ATCAAACCAAAATGGATTAAAGG - Intronic
1099183360 12:79492425-79492447 ATCAAACAGAAGTGGTATATAGG - Intergenic
1100090668 12:90965842-90965864 ATCTAAAAGAAATTTAACAAAGG - Intronic
1100210521 12:92393942-92393964 ATAGGACAGAAATGGAACATGGG + Intergenic
1100290584 12:93210473-93210495 AGCAAACAAAAATGTAACATGGG - Intergenic
1100494587 12:95112597-95112619 CTCAAACAAAAAAAGAACAAGGG + Intronic
1100530618 12:95458066-95458088 ATAGGACAGAAATGGAACATGGG - Intergenic
1100785012 12:98069648-98069670 TTCAAACAGAGATGGAGGAAAGG + Intergenic
1100952068 12:99862409-99862431 ATCAAAAAGAAAAAGCACAAAGG + Intronic
1103460591 12:121101675-121101697 ATCAAATCAAAATGGAATAAAGG + Intergenic
1104766773 12:131335138-131335160 ATAGGACAGAAATGGAACATGGG + Intergenic
1105232117 13:18506051-18506073 ATGAAACAGAAAGTTAACAAGGG + Intergenic
1105443532 13:20434511-20434533 ATAGGACAGAAATGGAACAGGGG + Intronic
1105901725 13:24760788-24760810 CTCAAACAGAAAGTGAGCAAAGG + Intergenic
1106316009 13:28594325-28594347 ATTAAACAAAAATAAAACAAGGG + Intergenic
1108980932 13:56512782-56512804 CTCAATCACAGATGGAACAATGG - Intergenic
1109118220 13:58418089-58418111 ATAAAACACAAATGTAACTAGGG + Intergenic
1109147127 13:58792934-58792956 ATCAAAAAGAATTAGAGCAAAGG - Intergenic
1109485949 13:63019872-63019894 ATAAATCACAAATGAAACAATGG - Intergenic
1109739600 13:66535034-66535056 ATCAAGCAGATTTGGATCAAAGG - Intronic
1109917357 13:69007938-69007960 AACAAACAGAATAGGAATAATGG - Intergenic
1110121150 13:71883235-71883257 ATAAAATAGAAATGGTCCAAAGG - Intergenic
1110536424 13:76655840-76655862 GTCATACAGAAAGGGAACCAAGG + Intergenic
1111003008 13:82209732-82209754 AGCAGACAGAACAGGAACAATGG - Intergenic
1111371045 13:87317396-87317418 TCCAAACAGGAATGGAACCATGG - Intergenic
1111689990 13:91551682-91551704 AACAAACAGAAAAGAAACAAAGG - Intronic
1111906184 13:94258908-94258930 ATCAAACAGAGATGTAACAAGGG + Intronic
1112358575 13:98695871-98695893 ATAACAGAGAAATAGAACAACGG - Intronic
1113274228 13:108710335-108710357 ATCAAACAAAAGTAGAACAAAGG - Intronic
1114362220 14:21986758-21986780 AACAGACAGAAGAGGAACAATGG - Intergenic
1114911568 14:27205661-27205683 ATAAAACTGAATTGTAACAAAGG + Intergenic
1115460141 14:33651015-33651037 ATCAAACACAAAGGGAAGAAAGG + Intronic
1115986939 14:39112056-39112078 ATCAACTACCAATGGAACAATGG - Intergenic
1116315449 14:43384965-43384987 AGCAAACAAAAATAGAAAAATGG + Intergenic
1116370002 14:44118125-44118147 CACAATCAGAAATGGGACAAAGG - Intergenic
1117650502 14:57899997-57900019 ATCGGACAAAAATGGAACATGGG - Intronic
1118434356 14:65756036-65756058 AACAAAGAGAAATGGTAGAAAGG + Intergenic
1120276566 14:82382412-82382434 ATGACACAGAAGTAGAACAATGG + Intergenic
1120418475 14:84251364-84251386 ATCAAATAGAAAAGCAAAAAAGG + Intergenic
1120618077 14:86732392-86732414 ATCAGACACCAATGGAACATGGG - Intergenic
1121902990 14:97711447-97711469 ATCACAAAGAAAAGGAAAAAAGG + Intergenic
1123896168 15:24832539-24832561 ATAGGACAGAAATGGAACATGGG + Intronic
1124655976 15:31507677-31507699 ATAGGACAGAAATGGAACATGGG - Intronic
1124690682 15:31819210-31819232 ATAAATCACAAATGGAATAAAGG + Intronic
1125645553 15:41269474-41269496 GACAAACAGAAATGAGACAAGGG - Intronic
1126301960 15:47207269-47207291 GTCAAGCACAAATGGAGCAAAGG - Intronic
1127191556 15:56536716-56536738 ATGAAGCAGAAAGGGGACAATGG + Intergenic
1127290751 15:57568700-57568722 ATCACAGGGAAATGGAGCAATGG - Intergenic
1127342586 15:58063780-58063802 AACAATCAGAAATGAAATAATGG - Intronic
1127802403 15:62488626-62488648 ATCAGACAGAATTGGAAGACTGG - Intronic
1129492989 15:75947626-75947648 ATCTAAAAGAAATGAAAGAATGG - Intronic
1129811350 15:78513044-78513066 AACAAACAGAAAGGGGACACAGG - Intronic
1129903398 15:79169119-79169141 ACCAAACAGAATGTGAACAATGG - Intergenic
1130011311 15:80154803-80154825 ATCAACCAGAAATGGAAGGAAGG - Intronic
1130826506 15:87552346-87552368 ATCATACAGAAATGGAAGTTAGG - Intergenic
1130999313 15:88925856-88925878 ATCAGACAGAAATGAAAATAAGG - Intergenic
1131017898 15:89072725-89072747 ATCAATAAGAAATGGATGAATGG - Intergenic
1131027604 15:89157962-89157984 ATCAAACACAAAGAAAACAATGG + Intronic
1131059228 15:89394335-89394357 AGCAAACAGAAGTAGAACAAAGG - Intergenic
1131568506 15:93507447-93507469 TTCAAGCAAAACTGGAACAATGG + Intergenic
1131959024 15:97768704-97768726 ATCATAGACAGATGGAACAAGGG + Intergenic
1133949154 16:10375713-10375735 ATCACACAGAAATAAAATAAGGG + Intronic
1134052712 16:11147952-11147974 GTCAAAAAGAAATGGAAAAAAGG - Intronic
1134506748 16:14813888-14813910 GTCAAACAGAAAGGGAAAAAGGG - Intronic
1134573810 16:15314933-15314955 GTCAAACAGAAAGGGAAAAAGGG + Intergenic
1134728610 16:16441385-16441407 GTCAAACAGAAAGGGAAAAAGGG - Intergenic
1134851024 16:17479186-17479208 ACCAAACAGGAAAGGAAGAATGG - Intergenic
1135177300 16:20241723-20241745 ATCAAAAAGAAATGAAAGAAAGG - Intergenic
1138484780 16:57332086-57332108 GACAAATAGAAATGAAACAACGG - Intergenic
1138493873 16:57395040-57395062 ATAGGACAGAAATGGAACATGGG - Intergenic
1140249804 16:73286234-73286256 TAAAAACAGTAATGGAACAACGG + Intergenic
1140660299 16:77183971-77183993 AACAAATAGAATTGGAACAGTGG - Intergenic
1140784207 16:78324442-78324464 ATCAAAGAGAAATGAAAACATGG + Intronic
1140919309 16:79522219-79522241 ATCAAACAGCACTGGAACAGTGG - Intergenic
1141272156 16:82551121-82551143 ACCAAACAGAAGTGGAAGAAGGG + Intergenic
1141349976 16:83285888-83285910 ATCACAGAGAAGTGGGACAAGGG + Intronic
1143181439 17:4986733-4986755 ATCAAACAGAGAAGGAACTCAGG - Intronic
1143768336 17:9151999-9152021 ATAGGACAGAAATGGAACATGGG + Intronic
1143799406 17:9366219-9366241 AACAAACAAAAATGTAACACAGG - Intronic
1144823089 17:18089072-18089094 TTCAAACCTAAATGGAACCAAGG - Intronic
1145404631 17:22575852-22575874 ATCAAAAAGAGATGAAAAAATGG - Intergenic
1146106394 17:30041113-30041135 CTCAATCACAGATGGAACAATGG - Intronic
1146830592 17:36065866-36065888 ACCCAAAAGAGATGGAACAAAGG - Intronic
1147111698 17:38267007-38267029 AGCAAACAGAAATAGAGCCAAGG - Intergenic
1147695670 17:42350777-42350799 ATCCAACAGAAATAGAATACAGG + Intronic
1148221046 17:45862174-45862196 ATAGGACAGAAATGGAACATGGG - Intergenic
1148417878 17:47521793-47521815 AGCAAACAGAAATAGAGCCAAGG + Intergenic
1148940461 17:51205343-51205365 ATAAAACAGAAATGTAAAATCGG + Intronic
1149029235 17:52065091-52065113 ATGTATGAGAAATGGAACAAAGG - Intronic
1150022971 17:61639236-61639258 ATCAAATCAAAATGGATCAAAGG + Intergenic
1150981905 17:70151806-70151828 ATCACAGAGAAAAGTAACAAGGG + Intergenic
1151010309 17:70485555-70485577 ATCAAACATGAATGGAAAAAGGG + Intergenic
1151149503 17:72072142-72072164 ATAAATCAGAAATGGGAGAAAGG + Intergenic
1152064876 17:78105403-78105425 ATGAAAAAGTAATGAAACAAGGG - Exonic
1153132531 18:1872584-1872606 ATGTAACTGAAAGGGAACAAAGG + Intergenic
1153695793 18:7640060-7640082 ATCAAAAATAAATGGCAGAATGG + Intronic
1153862086 18:9222206-9222228 AGAAAACAGAAATGGGGCAATGG - Intronic
1154521207 18:15232655-15232677 ATGAAACAGAAAGTTAACAAAGG - Intergenic
1154973031 18:21429341-21429363 CTCAAAAAGAAAAGGAAGAAAGG - Intronic
1155184572 18:23376069-23376091 AGCAAACAGCAAAGGATCAAAGG + Intronic
1155477073 18:26245496-26245518 ATAGGACAGAAATGGAACATGGG - Intronic
1155673544 18:28401899-28401921 ATCATAGAGAAATGTAACAGTGG + Intergenic
1156099402 18:33575865-33575887 TTCAAACACAAATGCAATAAAGG - Intergenic
1156977033 18:43235188-43235210 ATCAAATAAAAATGGACTAAAGG - Intergenic
1157244285 18:46039855-46039877 ATTAAACACAAATGAAAAAAAGG + Intronic
1158096234 18:53774739-53774761 ATCAAAAAGACAGGGAATAACGG - Intergenic
1158105826 18:53884075-53884097 ATGAAGCAGAAATGGAATTATGG - Intergenic
1158128296 18:54125962-54125984 ATCAAAATGAAATGGAATCAAGG + Intergenic
1158163369 18:54511205-54511227 ATCAAATAAAAATGGATTAAAGG + Intergenic
1158173579 18:54627227-54627249 ATCAAACAGCAAAGGCACACAGG + Intergenic
1158619038 18:59014966-59014988 TTCAAAAAGAAATAGAAAAATGG + Intergenic
1158811945 18:61047852-61047874 ATAGGACAGAAATGGAACATGGG + Intergenic
1158857247 18:61554911-61554933 ATCAAAAAGAAAAGAAAAAAAGG - Exonic
1159605187 18:70467680-70467702 AACAAACAGAAAAGAAAAAAAGG - Intergenic
1159750432 18:72293983-72294005 ATCAAAAAGACAGGGAATAATGG + Intergenic
1160473388 18:79159992-79160014 ATTAAATAGAAATGGATTAAAGG - Intronic
1162493864 19:11012007-11012029 ATAAAACAATAATGAAACAAAGG + Intronic
1162863823 19:13528633-13528655 GTCCAACAGAAATACAACAAGGG - Intronic
1162863900 19:13529158-13529180 CTCCAACAGAAATACAACAAGGG - Intronic
1164196761 19:22973882-22973904 ATACAACAGAAATGAAAAAAAGG + Intergenic
1164633236 19:29775188-29775210 ACAAGACACAAATGGAACAAGGG + Intergenic
1165136191 19:33671042-33671064 GTGAAATAGAAACGGAACAATGG - Intronic
1165189690 19:34052423-34052445 ATAAAACAGAAATGAAGAAAAGG + Intergenic
1165482425 19:36072539-36072561 ATAAAACAGACTTGCAACAAAGG - Intronic
1165908070 19:39205804-39205826 AGCCAATAGAAATGAAACAAGGG + Intergenic
1165971882 19:39638576-39638598 CTCAAACTGGAAAGGAACAAGGG + Intergenic
1167742893 19:51334960-51334982 AAAAAACAAAAAAGGAACAATGG + Intronic
1168464554 19:56591049-56591071 AACAAACAGTGCTGGAACAATGG + Intergenic
925576828 2:5369018-5369040 AAAAAACAGAAAAGGAAAAAAGG - Intergenic
927044988 2:19268881-19268903 ATCAAAAAGAAAGGCAATAATGG + Intergenic
927679311 2:25129570-25129592 ACAAAACAGAAGTGGAAGAAAGG - Intronic
928037943 2:27843781-27843803 ATCAAACAGAAACAGAACTAAGG + Intronic
928050064 2:27983168-27983190 ATCAAACAAAAAAATAACAAGGG - Intronic
928106702 2:28475165-28475187 ATAGGACAGAAATGGAACATAGG - Intronic
928868792 2:35950331-35950353 AACAAACAGACATGGTACAGAGG - Intergenic
928931656 2:36631362-36631384 CTCAATCACAGATGGAACAATGG - Intronic
929135123 2:38616513-38616535 ATCCAACAGATTTGGAACAAGGG + Intergenic
929171887 2:38940546-38940568 AACAAACAGGAATCGAACAGAGG - Intronic
930132090 2:47862361-47862383 ATTCAAAAGAAATGAAACAAAGG + Intronic
930324511 2:49898386-49898408 ATCAAAGAGGAATTGTACAATGG + Intergenic
930487549 2:52026770-52026792 ATCAGACACCAATGGAACATGGG + Intergenic
930570157 2:53076431-53076453 ATCAAAAGGAAAAGGAACATGGG + Intergenic
931043872 2:58327915-58327937 ATGAGACAGAAAGGCAACAAGGG + Intergenic
931258183 2:60593302-60593324 ATCAAAAAGACAGGGAATAATGG + Intergenic
931583383 2:63801551-63801573 ATAGGACAGAAATGGAACATGGG - Intronic
932536764 2:72605596-72605618 AACAAACAGAAAAAGAATAAAGG - Intronic
932982095 2:76681563-76681585 ATAGGACAGAAATGGAACATAGG + Intergenic
933310426 2:80653881-80653903 ATCAAAAGCAAATGGAACACAGG + Intergenic
933431914 2:82192851-82192873 AAAAAAAAGAAAAGGAACAAAGG + Intergenic
934094760 2:88590605-88590627 ACTAAACAAAAATGGAAAAAAGG + Exonic
934539274 2:95160553-95160575 ACCCAAAAGAAATGGAAAAACGG + Intronic
934569659 2:95361197-95361219 ATTACCCAGAAATGGAAGAAAGG - Intronic
935508823 2:103944848-103944870 AACAATCAGAAAAAGAACAAAGG + Intergenic
937496479 2:122425817-122425839 AAAAAACAGAAATGGAATGAAGG - Intergenic
938056144 2:128216217-128216239 ATAGGACAGAAATGGAACATGGG + Intergenic
938520559 2:132066421-132066443 ATGAAACAGAAAGTTAACAAGGG - Intergenic
938584116 2:132671565-132671587 ACCAAATAGAAATGAAAGAAGGG - Intronic
939307226 2:140427196-140427218 ATCAGACACCAATGGAACATGGG - Intronic
939881705 2:147639152-147639174 ATCAAACAAATATGTAACCAGGG + Intergenic
939912367 2:147998923-147998945 ATAAAACAGAAATGAAAGGATGG + Intronic
940216631 2:151309872-151309894 ATCAGACACCAATGGAACATGGG - Intergenic
940480387 2:154222109-154222131 AGCAGGCAGAAATGGAACAATGG - Intronic
942831794 2:180245261-180245283 AACACACACACATGGAACAAGGG - Intergenic
942844784 2:180410792-180410814 ATCAAACAACAATTGAACAAAGG + Intergenic
943198018 2:184780562-184780584 ATGAAACAGAAAATGAAAAATGG + Intronic
943294284 2:186117180-186117202 ATATAACAGAAAAAGAACAAAGG - Intergenic
943300637 2:186193772-186193794 ATGAAATAGAAAAGGAAAAATGG + Intergenic
943988282 2:194652418-194652440 ACCAAACAAAAAGGGAAAAATGG + Intergenic
944791010 2:203126935-203126957 ATCAAACTGAGAAAGAACAAGGG - Intronic
944832246 2:203544613-203544635 ACCAAACAGAGAAGGAAAAAAGG - Intergenic
946069690 2:217023117-217023139 AACAAATACAAAAGGAACAATGG + Intergenic
946571845 2:221033075-221033097 AAAAAAAAGAAATGGAACTATGG - Intergenic
946971668 2:225099966-225099988 ATCAAAGAGCTATGGAACAATGG - Intergenic
947090983 2:226511133-226511155 ATCAATCAGTCATGGAACATGGG + Intergenic
947302924 2:228708394-228708416 CTCAAACAAAAATGGCTCAAGGG - Intergenic
947321496 2:228924555-228924577 ATCAAGCAGAATAGGAGCAAAGG - Intronic
947395765 2:229685571-229685593 ATTAAAGAGAAATGGATAAACGG + Intronic
948355242 2:237372504-237372526 ATCAAAGAGAAGGGGAGCAAAGG + Intronic
948529171 2:238593053-238593075 AAAAAATAGAAATGAAACAAAGG - Intergenic
948724132 2:239921437-239921459 ATAGGACAGAAATGGAACATGGG - Intronic
1169530987 20:6484792-6484814 ATGAAATAGAAATGGGATAATGG - Intergenic
1169853565 20:10078980-10079002 ATAGGACAGAAATGGAACACAGG - Intergenic
1170149554 20:13215552-13215574 ATCACACAGAAATGCAGTAAAGG + Intergenic
1170409160 20:16069824-16069846 ATGAAACAGAAATGGGTGAAAGG + Intergenic
1171161546 20:22929106-22929128 ATCAAATAGAAAGGGAAAAATGG - Intergenic
1171382631 20:24745098-24745120 AGAAAACAGAAAAGAAACAAAGG - Intergenic
1171535646 20:25886186-25886208 ATTAAAAACAAATGGAACATAGG + Intergenic
1171562806 20:26141710-26141732 ATCAAAAAGAGATGAAAAAATGG - Intergenic
1171572214 20:26263720-26263742 ATTAAAAATAAATGGAACATAGG - Intergenic
1171805440 20:29674994-29675016 ATTAAAAATAAATGGAACATAGG - Intergenic
1171838614 20:30181421-30181443 ATTAAAAATAAATGGAACATAGG + Intergenic
1172797449 20:37550801-37550823 ATCAAATAGAAATAGAGTAAAGG - Intergenic
1173103256 20:40107334-40107356 ATCAAGCAGAAACTGAACCATGG + Intergenic
1174661420 20:52216429-52216451 TTCAAGCTGAAATGGAAGAATGG - Intergenic
1176589811 21:8636233-8636255 AGCAAAAAAAAATGGAAAAAAGG + Intergenic
1176776091 21:13134349-13134371 ATGAAACAGAAAGTTAACAAGGG + Intergenic
1176934224 21:14847390-14847412 ACAAAAAAGAAGTGGAACAAAGG + Intergenic
1176939382 21:14905523-14905545 ATCAAATCAAAATGGATCAAAGG - Intergenic
1177969181 21:27767218-27767240 ATGGAACAGAAAAGGAAGAAGGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178254026 21:31034240-31034262 TTAAAACAGAAATGGAGCAAGGG + Intergenic
1178511382 21:33207676-33207698 GTAAAACAGAAAAGGAACTATGG + Intergenic
1178812490 21:35896842-35896864 ATCAAACAGTAATGGTGAAAGGG + Intronic
1179943879 21:44657625-44657647 ATGAAACAAAAGTGAAACAACGG + Intronic
1180272645 22:10613248-10613270 AGCAAAAAAAAATGGAAAAAAGG + Intergenic
1180524072 22:16237626-16237648 ATGAAACAGAAAGTTAACAAGGG + Intergenic
1181994719 22:26867965-26867987 ATCAAATAGGAAAGGAAGAAGGG - Intergenic
1182967819 22:34538788-34538810 ATAAAACACAAATGAAAGAAAGG - Intergenic
1183920948 22:41167788-41167810 AACAAACAGAAATAGAACAATGG - Intronic
1184196014 22:42928876-42928898 ATTAAACAGCAATGGGACATTGG + Intronic
1184988271 22:48150615-48150637 AACAAACAAAAAAGAAACAATGG - Intergenic
949349458 3:3110763-3110785 ATCAAACAGAAATGGAACAAAGG - Intronic
949722157 3:7002226-7002248 ATCAAACAGACCTGCCACAAAGG + Intronic
950451012 3:13065740-13065762 ACCCAACAGAAATGGAACCAGGG + Intronic
951275511 3:20680558-20680580 ATCAACCAGAAATGACAGAAGGG + Intergenic
951930903 3:27966189-27966211 CTCAAACAGAGATAGATCAATGG + Intergenic
952398447 3:32941285-32941307 ATCAAACATATATCAAACAAGGG - Intergenic
953121520 3:40047420-40047442 TTAAAATAAAAATGGAACAAGGG - Intronic
954352692 3:50058375-50058397 ATCAACCATAAATGGGAGAAGGG - Intronic
955081520 3:55661930-55661952 ATTAAACAGAAAGTGAAAAAGGG - Intronic
955184104 3:56698677-56698699 AGTAAACAGAAATTCAACAAAGG - Intergenic
955394041 3:58543160-58543182 ATCACAAAGAAAAGAAACAAAGG + Intergenic
957230930 3:77513367-77513389 ATCAAACAGGAATTGAAAACTGG - Intronic
957848431 3:85771689-85771711 ATCAAAAAGAAATGGAGAACAGG + Intronic
957951759 3:87136335-87136357 ATCTAACAGTAAGGGAACCAGGG - Intergenic
957972320 3:87398366-87398388 AACAAACAGACATTTAACAAGGG - Intergenic
958182763 3:90082013-90082035 ATCATACAGGAAAAGAACAAGGG + Intergenic
959186181 3:103050600-103050622 AACAAACAGAATAGGAAGAAAGG + Intergenic
959306869 3:104678295-104678317 ATAGGACAGAAATGGAACATGGG + Intergenic
959662768 3:108887836-108887858 AGCAAAGACAAATGGAAAAAAGG + Intergenic
959667448 3:108937354-108937376 AGCAAACAGAGAGGGAGCAACGG - Intronic
960240558 3:115336773-115336795 AAAAAACAAAAATGAAACAAAGG + Intergenic
960910057 3:122640850-122640872 AACAAAGAGAAATGGGCCAAAGG - Intergenic
961631636 3:128304035-128304057 ATCAAAAAGAAAAGAAACACTGG - Intronic
962053306 3:131842112-131842134 ACAAAACAGAAATGGCAGAATGG + Intronic
962106824 3:132398848-132398870 ACCAAAAAGAAATAGCACAAGGG - Intergenic
963096463 3:141546844-141546866 ATCAAATAAAAATGGATTAAAGG - Intronic
963197398 3:142547887-142547909 ATGAAACAGAAATTGAACTGGGG - Exonic
963612067 3:147482404-147482426 ATTAAACAGAAGTAGAACAAAGG - Intronic
964416094 3:156449537-156449559 ATCAAACTGTAATGCAAAAACGG - Intronic
965297993 3:166975091-166975113 AACAAACAAATAAGGAACAAAGG + Intergenic
965474286 3:169134962-169134984 AGCAAATAAAAATGCAACAAAGG + Intronic
965928106 3:174008154-174008176 ATGAAGAAGAAATGGAACAGAGG - Intronic
966435118 3:179875452-179875474 TTCAAACACAACTGGAAAAATGG - Exonic
966830035 3:183999963-183999985 AACAAGCAGAAATGTATCAAAGG + Intronic
968212698 3:196862129-196862151 ATAGGACAGAAATGGAACATGGG - Intergenic
969403137 4:6970484-6970506 AACAACAGGAAATGGAACAACGG + Intronic
969913759 4:10469461-10469483 AGTAAATAGAAATGGAAGAAAGG + Intergenic
970126807 4:12822865-12822887 ATCAATCAGAAACAGAACATTGG + Intergenic
970245286 4:14055182-14055204 ATGAAACAAAAATAGGACAATGG - Intergenic
970792076 4:19869353-19869375 ATCAAAAATAAATTTAACAAAGG - Intergenic
971379850 4:26086579-26086601 ATCAAACAGAACCGGAAAAGTGG + Intergenic
972132793 4:35859156-35859178 ATAGGACAGAAATGGAACATGGG - Intergenic
972144130 4:36000962-36000984 ATCAGAGAGAAATCCAACAAAGG - Intronic
972193238 4:36620544-36620566 ATCAACTGAAAATGGAACAAAGG + Intergenic
972431384 4:38985870-38985892 GAGAAACAGAAATGGAATAAGGG - Intronic
972900514 4:43676302-43676324 ATAAAACAGAAAAAGAATAAAGG - Intergenic
973061047 4:45725200-45725222 ACCAAACAAAAATGGAAAAATGG + Intergenic
973203068 4:47527219-47527241 AACAAACAGTACTGCAACAATGG + Intronic
973762232 4:54128518-54128540 ACCAAACAAAAATGGACAAATGG - Intronic
973844719 4:54899848-54899870 AAGAAAAAGAAATGGAAGAAAGG - Intergenic
973875563 4:55215040-55215062 ATCAAACAGACATAGTATAAGGG + Intergenic
974081050 4:57212973-57212995 ATTAAAAAAAAATGGAAAAAAGG + Intergenic
974107369 4:57485677-57485699 AGCAAACAGAATCAGAACAAAGG - Intergenic
974239481 4:59228033-59228055 ATTAAACTGAAATGAAGCAAGGG - Intergenic
974278036 4:59752175-59752197 ATACAACAAAAATGGAAGAAAGG - Intergenic
974703001 4:65475140-65475162 ATAAAACAGAAATGAATGAATGG - Intronic
975463173 4:74678474-74678496 ATCAAATCAAAATGGATCAAAGG - Intergenic
975570958 4:75817322-75817344 GTCAATAAGAAATGTAACAATGG + Intergenic
975597221 4:76060319-76060341 ATCAAACTGATATGAAATAAGGG - Intronic
976781582 4:88764976-88764998 ATTAAAAAGATATGAAACAAAGG + Intronic
978227824 4:106359728-106359750 AGAAAACAGAAAAGGAAGAAAGG + Intergenic
978247370 4:106590244-106590266 ACCAAACAAAAATGAGACAATGG - Intergenic
978834381 4:113131017-113131039 TTTAAATAGAAATGGTACAAGGG - Intronic
978867535 4:113532294-113532316 AACAAACAGAAAAAGAAGAATGG - Intronic
978950737 4:114555991-114556013 ATCAATCAGAAACAGAACATTGG - Intergenic
980311642 4:131137881-131137903 ATGACAAAGAAATGCAACAAGGG + Intergenic
980682383 4:136180380-136180402 ACCATAAATAAATGGAACAAAGG + Intergenic
981599734 4:146472764-146472786 ATTAAACAGACATAGAAAAATGG - Intronic
981960538 4:150532689-150532711 ATAAAACAGAAAGAGAAGAATGG + Intronic
982731579 4:158961403-158961425 TTCACACATAAATTGAACAAAGG + Intronic
982951591 4:161703828-161703850 ATGAAATATAAATGGAATAAAGG - Intronic
983015860 4:162610703-162610725 ATCAAAAAGAAATGAAAGGATGG + Intergenic
983612295 4:169661184-169661206 ATTAAACAAAAATGAAAAAAAGG - Intronic
983907896 4:173204499-173204521 AGAAAAAAGAAAAGGAACAAAGG - Intronic
983911385 4:173243411-173243433 GTTAAACAGAAATGGAAAAGAGG - Intronic
984091870 4:175385512-175385534 AACAAACAGAAAAGAAAAAAAGG + Intergenic
984152044 4:176145428-176145450 ATCAAAAAGGAATGGAAAACTGG + Intronic
985017492 4:185651692-185651714 CTCAAACAGAAGGGGAAAAAAGG + Intronic
985522875 5:387026-387048 ATCAAACGGATATGGAAACAAGG - Intronic
986008730 5:3692406-3692428 ATCCCAGAGAAATGCAACAAAGG - Intergenic
986567856 5:9133147-9133169 TTTTAACTGAAATGGAACAAGGG - Intronic
987496141 5:18647296-18647318 AACAAATAAAAATGGATCAAAGG - Intergenic
988317972 5:29656283-29656305 AACAAACAGAAAACAAACAATGG + Intergenic
989043605 5:37252923-37252945 ATTAAAGAAAAATTGAACAAGGG - Intergenic
989299838 5:39877919-39877941 TTGAAAAAGAAATGGAAAAATGG + Intergenic
989333167 5:40283762-40283784 ATCAAACAGAAAATGTACTATGG + Intergenic
989965655 5:50463651-50463673 ATCATACTGACATGGAAGAAAGG + Intergenic
990263234 5:54047981-54048003 CAAAAACAGAAATGAAACAAAGG - Intronic
991235628 5:64392682-64392704 AACAAATAGTATTGGAACAATGG + Intergenic
991504067 5:67305912-67305934 AATAAACAAAACTGGAACAAGGG + Intergenic
991545197 5:67773927-67773949 ACAAAACAGAAAAGGAATAATGG + Intergenic
992038991 5:72809503-72809525 ATTCAACATAAATGGAATAAAGG - Intergenic
993072350 5:83181102-83181124 AAAAAAAGGAAATGGAACAAGGG - Intronic
993612342 5:90070798-90070820 ATACAACAGAAAGGGAACAATGG - Intergenic
994521264 5:100839738-100839760 ATCAAAAAGAAATGATAAAATGG + Intronic
995235095 5:109819847-109819869 ATCAAACCGAAGTAAAACAAAGG - Exonic
995382757 5:111553028-111553050 TTCACACAGAACAGGAACAACGG - Intergenic
995511201 5:112911026-112911048 ATGAAACAGAAAAGGAAATACGG + Intronic
995635998 5:114191568-114191590 ATCAAACAGAGATGGGGCTATGG + Intergenic
996879424 5:128278070-128278092 ATCAAAGAGAAATGAAGAAATGG + Intronic
996980935 5:129493939-129493961 AACAAACAGAAATGTAACTAGGG - Intronic
997813764 5:136996800-136996822 ATAGGACAGAAATGGAACATGGG + Intronic
997895321 5:137710891-137710913 GTCACACAGAAAAGGAACAGTGG + Intronic
998047022 5:138996188-138996210 ATCAAAGAGACAGGGAATAATGG - Intronic
998378145 5:141704931-141704953 AACAAACAGTAAGGGCACAAGGG - Intergenic
998789710 5:145752887-145752909 AACAAACACAAATGAAAGAAGGG + Intronic
1001060320 5:168482799-168482821 AACTAACAGGAATTGAACAAGGG + Intergenic
1001767239 5:174260103-174260125 CTCCAACCAAAATGGAACAATGG - Intergenic
1001929318 5:175661509-175661531 ATCTAACAGAATTCGAACACTGG + Intronic
1002216696 5:177640070-177640092 ATTAAAAAGAAATAAAACAAGGG - Intergenic
1002384521 5:178856317-178856339 TGCCAACAGAAATGGAAGAAGGG - Intergenic
1002390144 5:178904634-178904656 CTACAACAGAAATAGAACAATGG - Intronic
1002889742 6:1322138-1322160 TTCAAACAGATATGATACAAAGG - Intergenic
1003242481 6:4357116-4357138 ATCAAGTAGAAGTAGAACAAAGG - Intergenic
1003260931 6:4515538-4515560 AGCAGACAGGAATGGAAGAATGG + Intergenic
1003982129 6:11399843-11399865 ATCAAAAAGACAGGGAATAATGG + Intergenic
1004532268 6:16464365-16464387 ACAGAACAGAAATGGAACATGGG + Intronic
1005880293 6:30052765-30052787 ATCAACCAAAAATGGATTAAAGG - Intergenic
1006809432 6:36810476-36810498 CTCAAATAGAAACGGAAAAAGGG + Intronic
1007008341 6:38389655-38389677 ATGACACAGAAATGGCACAAAGG + Intronic
1007030828 6:38624227-38624249 ATAGGACAGAAATGGAACATGGG + Intronic
1007865845 6:44969247-44969269 TTCAAACATAAATGGAATTAAGG - Intronic
1007942062 6:45790621-45790643 ATCTAACAGCAAAGGAACATTGG + Intergenic
1008300150 6:49827385-49827407 AACAAACCGAAACAGAACAAGGG + Intergenic
1008416723 6:51249356-51249378 ACCAAAGAGAAATGTGACAATGG - Intergenic
1009903438 6:69838304-69838326 ATCAAAAAGAAATTTCACAAGGG - Intergenic
1010266771 6:73876509-73876531 AACAAACAGAAATAAAACAAAGG + Intergenic
1010313159 6:74412176-74412198 ATCAAAGAGAATTGGAAGTACGG - Intergenic
1010329647 6:74608237-74608259 CTCAAAGGGAAAAGGAACAAAGG + Intergenic
1010625536 6:78133299-78133321 ATAGGACAGAAATGGAACATGGG + Intergenic
1010814601 6:80342624-80342646 AACGAAAAGAAAAGGAACAAAGG + Intronic
1010950184 6:82027446-82027468 AACAGACAAAAAGGGAACAATGG + Intergenic
1011162554 6:84407952-84407974 AGGAAAGAGAAATGGGACAATGG + Intergenic
1011225030 6:85096093-85096115 ATAGGACAGAACTGGAACAAGGG + Intergenic
1011536409 6:88380798-88380820 ATCAGTCAGACATGAAACAAAGG - Intergenic
1012049781 6:94327254-94327276 ACAAAACAGAAATGAATCAATGG - Intergenic
1012449053 6:99335675-99335697 CTCAATCACAGATGGAACAATGG - Intronic
1012731252 6:102885390-102885412 ATCAAACAGAAAAAGAGCATTGG - Intergenic
1012777444 6:103515902-103515924 ATCAAATAGAAAAGGATCCATGG - Intergenic
1012778897 6:103531859-103531881 ATCAAACAAAAATAAAACAAAGG - Intergenic
1013011641 6:106125894-106125916 AAAAAAAAGAAATGTAACAAAGG + Intergenic
1013019334 6:106196975-106196997 ATAAAACACAAATGTATCAAGGG + Intronic
1013046066 6:106487043-106487065 AACAAAGAGAAAGGAAACAAAGG - Intergenic
1013061785 6:106641558-106641580 AAGAAACAGAAATAGAAAAAAGG + Intronic
1013790558 6:113831929-113831951 ATAGGACAGAAATGGAACATGGG + Intergenic
1013933886 6:115570149-115570171 ATTAAAGAGACATGGACCAAAGG - Intergenic
1014313432 6:119833322-119833344 ATGAAACAGATATGGCAAAATGG + Intergenic
1014900440 6:126957273-126957295 ATCACAGAGAAGTGAAACAAAGG - Intergenic
1014965641 6:127745038-127745060 AGAAAAAAGAAATGAAACAATGG + Intronic
1015103353 6:129507077-129507099 TTCAAATAGAAATTGAACATAGG + Intronic
1015812144 6:137171505-137171527 TTCAAAGAGAAAGGGAAGAATGG + Intronic
1016031214 6:139340406-139340428 GTCAAACAGAAAAGAAACACAGG - Intergenic
1016445182 6:144124728-144124750 ATCAAGCTGAAATGGTACTACGG + Intergenic
1016449554 6:144167603-144167625 ATAAAAAAGAAATGAAAAAAAGG - Intronic
1016474419 6:144410746-144410768 ATCAAAAAGGAATGAAATAATGG - Intronic
1016684533 6:146866398-146866420 TTCAAACAAAAATGGCAGAAAGG - Intergenic
1016776908 6:147914447-147914469 ATTACACAGAATTGGAAAAAAGG + Intergenic
1016842949 6:148542826-148542848 ATCAACCAAAAATGTAACAAGGG + Intronic
1017611751 6:156194194-156194216 TACCAACAGAAATGGAAGAATGG - Intergenic
1017728019 6:157289087-157289109 ATCAAACAGTAATGAAACAAAGG + Intergenic
1018491819 6:164301860-164301882 ATAGGACAGAAATGGAACATGGG + Intergenic
1018492609 6:164309804-164309826 ATAAAAAAGAAATGGTAAAATGG + Intergenic
1019131050 6:169875181-169875203 ATCAAATCAAAATGGATCAAAGG - Intergenic
1019141826 6:169952454-169952476 ATCAAAGACCAATTGAACAAAGG - Intergenic
1019249356 6:170732907-170732929 ATCAAATAAAAATGGATTAAAGG - Intergenic
1019463078 7:1171783-1171805 ATAGGACAGAAATGGAACATGGG + Intergenic
1020075875 7:5258538-5258560 AGCAAACAGAGATGGATCAATGG + Intergenic
1020785254 7:12565709-12565731 AACAGACAGATATGGAAGAAGGG + Intergenic
1020959416 7:14783920-14783942 ATTTAACAGAAATTTAACAAGGG - Intronic
1021025079 7:15656781-15656803 ATCAAAAGGAAAAAGAACAATGG - Intronic
1021329915 7:19323906-19323928 TCCTATCAGAAATGGAACAAAGG + Intergenic
1022194745 7:28053928-28053950 AGCAAAAAGAAAAGGAAAAAAGG + Intronic
1023342352 7:39234802-39234824 ATGTAACAAAAATGGAACAATGG - Intronic
1023367861 7:39482597-39482619 AACAAAAAAAAATGGAACAGAGG - Intronic
1023414536 7:39919681-39919703 AGCAAAGAGTAATGGAAAAAAGG + Intergenic
1025145630 7:56499700-56499722 CTCAAATAGAAATTGAACAACGG + Intergenic
1025174545 7:56791454-56791476 CTCAATCACAGATGGAACAATGG + Intergenic
1025203209 7:56975024-56975046 AGCAAACAGAGATGGATCAATGG - Intergenic
1025287110 7:57672903-57672925 ATTAAAAATAAATGGAACATAGG + Intergenic
1025668735 7:63601903-63601925 AGCAAACAGAGATGGATCAATGG + Intergenic
1025697257 7:63784959-63784981 CTCAATCACAGATGGAACAATGG - Intergenic
1026082398 7:67233574-67233596 ATCCAACAGTAAGGGAAGAACGG - Intronic
1026493667 7:70884657-70884679 ATCAGAGATCAATGGAACAATGG + Intergenic
1026549758 7:71357957-71357979 ATTGGACAGAAATGGAACATGGG + Intronic
1026694673 7:72580419-72580441 ATCCAACAGTAAGGGAAGAACGG + Intronic
1027178633 7:75921687-75921709 ATCAACCAGCAATGGTACCATGG - Intronic
1028462635 7:91113137-91113159 ATCAAACAGAAATGAATCATCGG - Intronic
1028944203 7:96558267-96558289 ATGAAACAGAAAAGAAGCAAAGG + Intronic
1029263225 7:99318478-99318500 AGCAAACTGAAATGGACAAATGG + Intergenic
1029936455 7:104429986-104430008 ATCAAGGAGAAATGGCTCAATGG + Intronic
1029975803 7:104832122-104832144 ATGAAACTGAAAAAGAACAAAGG - Intronic
1030264366 7:107603576-107603598 ATGAAACAAAGAAGGAACAAAGG - Intronic
1030683778 7:112461447-112461469 AGCATACAGAAAGGAAACAAGGG + Intronic
1030688675 7:112510955-112510977 AGCAAACAGAAAGGGAAAAGAGG + Intergenic
1030866277 7:114704960-114704982 TACATACAGAAATGGTACAATGG + Intergenic
1032572614 7:133016501-133016523 ATCAAACAGAAATTTAAGATGGG + Intronic
1032937413 7:136749026-136749048 AACAAACAGAAATGGGAAAAAGG - Intergenic
1032962772 7:137058301-137058323 ATCAAACACAAATAGTAAAATGG + Intergenic
1033072379 7:138215938-138215960 ATCAGTCAGAAATGGAACATTGG - Intergenic
1033328176 7:140396783-140396805 ATCAAACACTAATAGAAGAATGG + Intronic
1035828896 8:2673296-2673318 ACCAAACAGAAATAGAGAAAGGG - Intergenic
1036003610 8:4637017-4637039 ATAGGACAGAAATGGAACATGGG + Intronic
1036228705 8:6981823-6981845 ATCAAACATATACTGAACAATGG - Intergenic
1036231157 8:7000933-7000955 ATCAAACATATACTGAACAATGG - Intronic
1037167095 8:15844098-15844120 AGAAAACAAAAATGAAACAAGGG - Intergenic
1037416254 8:18653113-18653135 ATCAAGCAGATATAAAACAAAGG - Intronic
1037632772 8:20673205-20673227 ATCAAACAGATTTGGCAGAAGGG + Intergenic
1037807013 8:22063676-22063698 ATCATGCAAAAATGGAAAAAGGG - Intronic
1038430022 8:27492689-27492711 ATAGGACAGAAATGGAACATGGG - Intronic
1038513213 8:28160461-28160483 GTCAAATAGAAATGGAATACAGG - Intronic
1039383825 8:37112756-37112778 ATATGACAAAAATGGAACAAAGG + Intergenic
1039673446 8:39631530-39631552 ATAAAACAGAAATAGGGCAATGG - Intronic
1039776783 8:40744994-40745016 AGAAAACAGACTTGGAACAAGGG + Intronic
1039997740 8:42548932-42548954 ATAAAATACAAAAGGAACAAAGG - Intronic
1040492081 8:47932864-47932886 ATCCAACAGAAATGCATCAGTGG + Intronic
1041838563 8:62244255-62244277 CCAAAACAGAAATGGAAAAAAGG + Intergenic
1042323614 8:67504727-67504749 AGCAACCAGAAATGGAACAAAGG - Intronic
1042594280 8:70429187-70429209 TTCAAACATAAATGAAAGAATGG - Intergenic
1042919251 8:73906264-73906286 ATAGGACAGAAATGGAACATGGG + Intergenic
1042920371 8:73913781-73913803 ATAGGACAGAAATGGAACATGGG + Intergenic
1043715445 8:83479350-83479372 AACAAAGAGAAATGAAGCAAAGG + Intergenic
1043744935 8:83862554-83862576 AGCAAACAGAAAAAGAAAAAGGG + Intergenic
1043822047 8:84878795-84878817 AAAAAACAGAAATGGAAAATAGG + Intronic
1044004601 8:86926021-86926043 ATAGGACAGAAATGGAACATGGG - Intronic
1044338137 8:91013920-91013942 ATAAAATATAAATGTAACAAAGG + Intronic
1044364289 8:91325139-91325161 ACCACACAGAAATTGAACAATGG - Intronic
1044864979 8:96562223-96562245 AACAAATAGAGCTGGAACAATGG - Intronic
1045674369 8:104590555-104590577 ATAGGACAGAAATGGAACATGGG - Intergenic
1045801003 8:106101010-106101032 ATCAAATCAAAATGGATCAAAGG + Intergenic
1046204074 8:110966467-110966489 TTCAAACATTAATGGAGCAAGGG + Intergenic
1046282057 8:112046134-112046156 GTCAATCAGAATTGAAACAAAGG - Intergenic
1046394011 8:113615616-113615638 ACCAAACAGAAATGGCAGATAGG + Exonic
1046398207 8:113669390-113669412 AACAAATAAACATGGAACAAGGG + Intergenic
1046677035 8:117121096-117121118 ATAAATAAGAAATAGAACAATGG + Intronic
1047310616 8:123688606-123688628 ATCAAACAGTCATGTAACACTGG - Intronic
1047377248 8:124312156-124312178 ATCAATCAGAAATTTTACAAAGG + Exonic
1047444992 8:124911781-124911803 CTCAATCACAGATGGAACAATGG - Intergenic
1047552570 8:125891668-125891690 ATAAAACAGAAATAGAGAAATGG - Intergenic
1049608775 8:143542402-143542424 AGAAAACAAAAATGGAACTACGG + Intergenic
1050337198 9:4601239-4601261 ATCAAAAAGAAAGGAAAGAAAGG - Intronic
1050356757 9:4791562-4791584 ATCAAAGAAAAATGGATTAAAGG + Intergenic
1050370095 9:4912153-4912175 ATAAAACAGTAATGGGGCAATGG - Intergenic
1050823738 9:9916365-9916387 ATAAAAGAAAAAAGGAACAAAGG + Intronic
1051089401 9:13388339-13388361 ATGAATCAGAGATGGCACAAGGG + Intergenic
1051098688 9:13496386-13496408 ATCAAACATAAAAGAAAAAAAGG + Intergenic
1051381598 9:16464404-16464426 ATCAAACAAACCTGGAAGAAGGG + Intronic
1051454191 9:17234636-17234658 ATAGATCAGAAATGGAATAAAGG + Intronic
1051834408 9:21318853-21318875 GTCATACAGAAATGAAAGAATGG + Intergenic
1052474474 9:28941024-28941046 ATAAAAGAGAAAGGGAAGAAGGG + Intergenic
1053168864 9:35864106-35864128 ATACAGCAGAAAAGGAACAAAGG - Intergenic
1053699853 9:40679230-40679252 ATGAAACAGAAAGTTAACAAGGG - Intergenic
1054311144 9:63478629-63478651 ATGAAACAGAAAGTTAACAAGGG - Intergenic
1054409929 9:64802781-64802803 ATGAAACAGAAAGTTAACAAGGG - Intergenic
1055709849 9:79048950-79048972 GTCAAACAGAAATATAACATAGG - Intergenic
1055799031 9:80011949-80011971 AACAAAAAGAAAAGGAAAAAAGG - Intergenic
1055823342 9:80294764-80294786 ATCAAACAGCAATGCAGAAAAGG - Intergenic
1055831588 9:80385664-80385686 ATCAAAAAGAAATAAAATAATGG + Intergenic
1057368567 9:94448160-94448182 TTCAATCAGACCTGGAACAAGGG - Intronic
1057557369 9:96098664-96098686 CTCAAAAACAAATGAAACAAAGG + Intergenic
1057876704 9:98761211-98761233 ATAAAACATAAATGTAAAAATGG - Intronic
1058098599 9:100892085-100892107 ATCAGTCAGAAATAGAACATTGG + Intergenic
1058170709 9:101677757-101677779 ATCAAACAGAATTGGACCACAGG - Intronic
1058316820 9:103578876-103578898 ATCAAAAAGACAGGGAATAATGG + Intergenic
1058330010 9:103748905-103748927 ATCAAAATTAAATGGAATAAGGG + Intergenic
1058654286 9:107205822-107205844 AGCATACAGAATTGGAAAAAAGG + Intergenic
1059839082 9:118191971-118191993 AACAAACAGGAAAGGAGCAAAGG + Intergenic
1059868169 9:118540456-118540478 AACAAATGGAGATGGAACAAAGG - Intergenic
1059901185 9:118927927-118927949 ATAAAACAGAAAAGGAAGAATGG - Intergenic
1060543154 9:124445233-124445255 ATAAAAAAGAAAAGGAAAAAAGG + Intergenic
1060834642 9:126745944-126745966 ATCAACCAGAAATCAAACACAGG - Intergenic
1061157746 9:128875213-128875235 ATTGAACATAAATGGAATAATGG - Intronic
1061640454 9:131950504-131950526 ATCAAATGGAAATGAAATAATGG - Intronic
1062310957 9:135936887-135936909 ATAAACCAGAAACTGAACAACGG + Intronic
1203619828 Un_KI270749v1:114880-114902 AGCAAAAAAAAATGGAAAAAGGG + Intergenic
1185965991 X:4603491-4603513 AGCAAACAAAAATGGACCATGGG + Intergenic
1186684968 X:11916424-11916446 GTCAATCAGAAAGGGAAAAAGGG + Intergenic
1186858468 X:13648192-13648214 TACAAAATGAAATGGAACAAGGG - Intergenic
1187845321 X:23530402-23530424 ATCAAATAAAAATGGATTAAAGG + Intergenic
1188236163 X:27733676-27733698 ATCAAATGGAAATGGATTAAAGG - Intronic
1188419296 X:29976337-29976359 ATCAGACACCAATGGAACATGGG - Intergenic
1188617400 X:32175378-32175400 ATAGGACAGAAATGGAACATGGG + Intronic
1188814936 X:34701275-34701297 ACCAAACAAAAATGGACAAATGG + Intergenic
1188866401 X:35318316-35318338 GTCAAAGAGAAATGGAGAAATGG - Intergenic
1189091489 X:38087701-38087723 ATCAAACAGAAGTTAATCAAAGG - Intronic
1189266571 X:39721217-39721239 ATGAATGAGAAATGGAAGAAAGG - Intergenic
1189392290 X:40586324-40586346 AACAAACAGTGAAGGAACAAAGG + Intronic
1189704423 X:43745590-43745612 ATCAAACAGAAAAGAAATTAGGG + Exonic
1189750883 X:44221125-44221147 AACACACAAAAATGGATCAAAGG - Intronic
1189967133 X:46386554-46386576 ATCAAACAGAGCTAGATCAAAGG - Intergenic
1190034399 X:47007327-47007349 AACAAACAGAAAATCAACAAGGG - Intronic
1191024830 X:55902772-55902794 ATCAACCCAAAATGGATCAAAGG - Intergenic
1191643889 X:63457868-63457890 ATCAGTCAGAAATAGAACACTGG - Intergenic
1191789640 X:64955886-64955908 ATCAGTCAGAAAGGGAACATTGG + Intronic
1192288550 X:69765380-69765402 ACCAAAGAGAAATGGAACTAAGG - Intronic
1192705293 X:73523227-73523249 ATCAAACAATAAAGGAAGAATGG - Intergenic
1192947120 X:75976289-75976311 ATCAAAAAGACAGGGAATAATGG - Intergenic
1193180880 X:78455153-78455175 ATCAGACAGAAATGAAAATAGGG + Intergenic
1193659616 X:84241080-84241102 ACCAAAAAGACATGGAACACTGG + Intergenic
1193816432 X:86109743-86109765 ACCAAGCAGAAATGGACAAATGG + Intergenic
1193846615 X:86479410-86479432 ATCAAACTGATATGGAACAGGGG - Intronic
1193976786 X:88130184-88130206 ATCATACAGAAAATGTACAAGGG + Intergenic
1194256748 X:91644615-91644637 ATCAAGCAAAAATGGATAAATGG - Intergenic
1195504372 X:105640336-105640358 CTCATACAGAGATGGAAGAAGGG - Intronic
1195621605 X:106961680-106961702 ATAGGACAGAAATGGAACACGGG + Intronic
1195731352 X:107971190-107971212 CCCAAACAGAAATACAACAAAGG - Intergenic
1196312895 X:114189168-114189190 ATAGGACAGAAATGGAACACTGG + Intergenic
1196584923 X:117418698-117418720 ATCAGACACCAATGGAACATGGG - Intergenic
1196809748 X:119619708-119619730 AGCAACCAGAACTGGAACAGGGG + Intronic
1197028165 X:121781051-121781073 ATCAAATCAAAATGGAATAAAGG - Intergenic
1197172154 X:123446266-123446288 ATCAAACAGATATGCAAAATAGG - Intronic
1197508743 X:127344001-127344023 ACCAAGCAAAAATGGAAAAATGG + Intergenic
1198026982 X:132716617-132716639 ATCAAACTGAAATGCATCACTGG - Intronic
1198338438 X:135690735-135690757 ATGAAACAGAAATGGTACTGTGG + Intergenic
1199040297 X:143107081-143107103 AACAAACAAAAATGGACAAACGG + Intergenic
1199334445 X:146601484-146601506 ATCAAACATAGATGGATAAATGG - Intergenic
1199623206 X:149716873-149716895 ATCAAACACAGAGGGAAGAATGG - Exonic
1199694453 X:150334136-150334158 ATCAATCAGAAATGAAAATATGG + Intergenic
1199934412 X:152558042-152558064 AACACACAGAAAAGGAACTATGG - Intergenic
1200333991 X:155328949-155328971 ATCAAATACAAATGGATTAAAGG + Intronic
1200575465 Y:4883877-4883899 ATCAAGCAAAAATGGATAAATGG - Intergenic
1201454810 Y:14158516-14158538 ATAAGACAGAAATGGAACATGGG + Intergenic
1201456026 Y:14167548-14167570 ATAGGACAGAAATGGAACACGGG + Intergenic
1201476094 Y:14382327-14382349 ATCAAACTGAAATTCAAGAAAGG + Intergenic
1201545197 Y:15154339-15154361 ACCAAACAGAGATAGATCAATGG - Intergenic
1201737371 Y:17282907-17282929 ATCAAACCAAAATGGATTAAAGG + Intergenic
1201757816 Y:17506081-17506103 ATAAAACAGAAATAAAGCAACGG - Intergenic
1201843738 Y:18399901-18399923 ATAAAACAGAAATAAAGCAACGG + Intergenic
1201913300 Y:19155810-19155832 ATAGGACAGAAATGGAACATGGG + Intergenic