ID: 949351310

View in Genome Browser
Species Human (GRCh38)
Location 3:3127122-3127144
Sequence TATTTTGCCCACTGCTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949351310_949351317 15 Left 949351310 3:3127122-3127144 CCTCCTCAGCAGTGGGCAAAATA 0: 1
1: 0
2: 0
3: 16
4: 163
Right 949351317 3:3127160-3127182 TCGTGTCCCCGCCACGTTTCCGG 0: 1
1: 0
2: 0
3: 1
4: 24
949351310_949351313 -8 Left 949351310 3:3127122-3127144 CCTCCTCAGCAGTGGGCAAAATA 0: 1
1: 0
2: 0
3: 16
4: 163
Right 949351313 3:3127137-3127159 GCAAAATAGCCCCGACGCGGAGG 0: 1
1: 0
2: 0
3: 13
4: 229
949351310_949351321 25 Left 949351310 3:3127122-3127144 CCTCCTCAGCAGTGGGCAAAATA 0: 1
1: 0
2: 0
3: 16
4: 163
Right 949351321 3:3127170-3127192 GCCACGTTTCCGGCGACCGCAGG 0: 1
1: 0
2: 0
3: 0
4: 15
949351310_949351323 30 Left 949351310 3:3127122-3127144 CCTCCTCAGCAGTGGGCAAAATA 0: 1
1: 0
2: 0
3: 16
4: 163
Right 949351323 3:3127175-3127197 GTTTCCGGCGACCGCAGGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949351310 Original CRISPR TATTTTGCCCACTGCTGAGG AGG (reversed) Intronic
901780651 1:11592402-11592424 TAATCTGCCCACTGTTGATGAGG + Intergenic
906288521 1:44603945-44603967 TTTATTGCCCACAGCTGCGGAGG + Intronic
909690852 1:78406411-78406433 TGTTTTGCTCACTGCTGCTGGGG + Intronic
910721883 1:90295508-90295530 AATTTTGCTGACTGGTGAGGTGG + Intergenic
911385166 1:97165739-97165761 TATTTTGCCCACTTATTAAGGGG - Intronic
914959158 1:152190891-152190913 TATTTTGCTAACTGGTGTGGAGG + Intergenic
916438277 1:164797096-164797118 CGTTTCACCCACTGCTGAGGTGG - Intronic
917075002 1:171195606-171195628 TATTTTTCCAACTGCTGGGTTGG - Intronic
919216380 1:194561846-194561868 TATTTTCCACACTGCTGATCAGG + Intergenic
919384301 1:196899413-196899435 TATATTCCCAACTGCTTAGGAGG - Intronic
919840588 1:201606272-201606294 TGTTTTGCCCACAGGAGAGGAGG - Intergenic
924250637 1:242129695-242129717 TATTTTGCTCAGTGGTGAAGTGG + Intronic
1063153733 10:3359224-3359246 TATTTGGCCCAGCACTGAGGAGG - Intergenic
1064018999 10:11794334-11794356 TAGTTTGCCCAGTGCTGGGAAGG - Intergenic
1065193760 10:23240753-23240775 TATTTTGGACTCTGCTGAGATGG - Intergenic
1065927481 10:30448289-30448311 CATTCCGCCCACTGCAGAGGGGG + Intronic
1069024854 10:63528521-63528543 TATTTTGGCTGCTGTTGAGGAGG - Intronic
1069815108 10:71188712-71188734 CCTTCTGCCCACTGCTGGGGAGG - Intergenic
1070513372 10:77181050-77181072 TGTTCTGCTCACTGCAGAGGAGG + Intronic
1071356558 10:84802193-84802215 TGTCTTGGCCACTGTTGAGGCGG + Intergenic
1074392013 10:113065852-113065874 TGCTTTGCCCAATGCTTAGGAGG + Intronic
1074969276 10:118522341-118522363 TAACTTGCCCACAGCTGATGAGG + Intergenic
1075705807 10:124499708-124499730 TCTGCTGCCCACTTCTGAGGAGG - Intronic
1077701833 11:4449566-4449588 CATTTTGGGCAGTGCTGAGGAGG - Exonic
1077704839 11:4475032-4475054 CATTTTGGGCAATGCTGAGGAGG - Intergenic
1079021280 11:16911242-16911264 TAGTTTTCCCACAGGTGAGGAGG - Intronic
1080722520 11:34863669-34863691 TATTTTGCAGACTTCTGAGTTGG + Intronic
1080945817 11:36972941-36972963 TATTTTTCCAAGTGCTGATGAGG + Intergenic
1081726463 11:45332874-45332896 TATTATGCCCACTGCACAGATGG - Intergenic
1083343750 11:61975352-61975374 TACTTTGCCAGGTGCTGAGGTGG - Intergenic
1086070895 11:82797807-82797829 AATTTGCCCCACTGGTGAGGAGG - Intergenic
1086568213 11:88251128-88251150 TATTTTTCACCCTTCTGAGGAGG - Intergenic
1086980631 11:93194410-93194432 TATTTTGTTCATTTCTGAGGTGG + Intronic
1088066940 11:105731196-105731218 TATTTTGCCCATTTTTGATGGGG - Intronic
1091288680 11:134424299-134424321 AAATTTGCCCTCTGCTGAAGAGG - Intergenic
1091451456 12:574856-574878 TATTATTCCCACTTCAGAGGAGG - Intronic
1095563947 12:43598644-43598666 TACTTTGACTCCTGCTGAGGAGG + Intergenic
1097683901 12:62674631-62674653 GATTTTGCCTAATGCAGAGGTGG - Intronic
1100495718 12:95123137-95123159 TATTTTGTGCCCTGGTGAGGAGG - Intronic
1102209450 12:111114415-111114437 TATTTTGCCCATTGTTTAGTTGG + Intronic
1104411447 12:128561550-128561572 TAATATGCCCACTGCTTAGAAGG - Intronic
1109968411 13:69732870-69732892 TATTTGGGCCACTGCTTAGCTGG - Intronic
1114757378 14:25274914-25274936 GATTATGCCCAATGCTGATGAGG - Intergenic
1117679882 14:58193035-58193057 TCTTCTGCCCATTGCTGAGGTGG - Intronic
1119855440 14:77897003-77897025 TATTTTGCCCAATGCTGTGTTGG - Intronic
1123695300 15:22874639-22874661 TATTTTTTCTACTGCAGAGGGGG - Exonic
1127544479 15:59977803-59977825 TATTTTGCCCATTGCTGGCTTGG + Intergenic
1128383718 15:67132331-67132353 TGTTTTGCCCATTTCTGAGATGG + Intronic
1128949688 15:71864150-71864172 TATTTTGCCCATTTTTGAGTTGG - Intronic
1130537180 15:84794813-84794835 TAATTTGCCCACTTCTGAATTGG + Intronic
1132119345 15:99163260-99163282 GATTTTGCCTGCTGCTGAGATGG + Intronic
1132144750 15:99422755-99422777 TCTTTTGCCCACTTCTGAATGGG + Intergenic
1133045394 16:3085760-3085782 TAATTATCCCACTGCAGAGGTGG + Intergenic
1135727969 16:24871855-24871877 TGTTTTAATCACTGCTGAGGAGG + Intronic
1136737868 16:32478747-32478769 TATTTTGCCCTCCGCTGCCGCGG - Intergenic
1136957543 16:34803380-34803402 CTTTTTGCCCACCGCCGAGGCGG + Intergenic
1137888129 16:52128440-52128462 TATTTTGCCCTCTGGTAAGTAGG + Intergenic
1138929788 16:61639129-61639151 TATTTTGTCCACTGATTATGAGG - Intergenic
1141562740 16:84880332-84880354 TATCTTTACCTCTGCTGAGGGGG + Intronic
1203015204 16_KI270728v1_random:350830-350852 TATTTTGCCCTCCGCTGCCGCGG + Intergenic
1203033539 16_KI270728v1_random:623988-624010 TATTTTGCCCTCCGCTGCCGCGG + Intergenic
1142500767 17:331707-331729 TAGTTTACCCACTGGTGAAGGGG - Intronic
1143267033 17:5645995-5646017 TATTTTGCATACTGCTGGAGAGG + Intergenic
1143292212 17:5840048-5840070 TGTTTTGCCCAAAACTGAGGTGG - Intronic
1144756680 17:17683725-17683747 TATTTTGCCCACTCCACAGTTGG - Intronic
1149974254 17:61250209-61250231 TATTTAGCACATTGCTGAGGGGG - Intronic
1151869235 17:76825368-76825390 TATTCAACCCACTGCAGAGGAGG + Intergenic
1166566192 19:43767045-43767067 TACTTTCCCCAGTACTGAGGTGG - Exonic
1167537535 19:50064381-50064403 TCTGATGCCCATTGCTGAGGTGG - Intergenic
1168538350 19:57190890-57190912 GGATTTGCCCACTTCTGAGGTGG - Intergenic
927927708 2:27025100-27025122 TCTTTTGCCCTCTGCTGGGCTGG - Intronic
928201078 2:29247745-29247767 TTCTCTGCCCACTGCTGGGGAGG - Intronic
931800254 2:65751124-65751146 TATTTTGCCCACCACAGAGCAGG + Intergenic
933312772 2:80681430-80681452 TGTTTTCCACAATGCTGAGGTGG + Intergenic
935241826 2:101185497-101185519 TTTTTTGCCTATGGCTGAGGTGG - Intronic
937458196 2:122062275-122062297 CATTCTGTGCACTGCTGAGGGGG + Intergenic
939034314 2:137112798-137112820 CCTTTTGCCCATTGCTGATGTGG - Intronic
940919311 2:159289529-159289551 TATAATACCCACTACTGAGGAGG + Intergenic
941236265 2:162978432-162978454 GATTTTGACCACTGTTGAGAGGG - Intergenic
945008836 2:205440115-205440137 TATCTTGCCCACTGATGACTAGG - Intronic
946168844 2:217881585-217881607 TATTTGTCCCAATGCTGAGCTGG - Intronic
948502585 2:238406202-238406224 AATTTTGCCCATTCTTGAGGTGG + Intergenic
1171940347 20:31322874-31322896 CATTTTGCCCATTGCTCTGGTGG - Intergenic
1172188187 20:33044560-33044582 GATTTTGCACACAGCTAAGGTGG - Intergenic
1174158487 20:48533364-48533386 TATTTTACACACTGCTGAGAAGG + Intergenic
1179724357 21:43333555-43333577 TGTTTTGCTCACTGGTGAGGAGG - Intergenic
1180759416 22:18188164-18188186 TATTATCCCCACTGCTCAGGTGG - Intergenic
1180769726 22:18372464-18372486 TATTATCCCCACTGCTCAGGTGG - Intergenic
1180776603 22:18490202-18490224 TATTATCCCCACTGCTCAGGTGG + Intergenic
1180809331 22:18747571-18747593 TATTATCCCCACTGCTCAGGTGG + Intergenic
1180827663 22:18875420-18875442 TATTATCCCCACTGCTCAGGTGG - Intergenic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1181072252 22:20352552-20352574 TATTATCCCCACTGCTCAGGTGG + Intronic
1181195326 22:21181493-21181515 TATTATCCCCACTGCTCAGGTGG + Intergenic
1181214121 22:21311281-21311303 TATTATCCCCACTGCTCAGGTGG - Intergenic
1181524572 22:23472919-23472941 TATTATCCCCACTGCTCAGGTGG - Intergenic
1184152281 22:42646119-42646141 TACTTGGCCCACTGCTGGTGAGG - Intronic
1203231555 22_KI270731v1_random:113648-113670 TATTATCCCCACTGCTCAGGTGG - Intergenic
1203277763 22_KI270734v1_random:101417-101439 TATTATCCCCACTGCTCAGGTGG - Intergenic
949351310 3:3127122-3127144 TATTTTGCCCACTGCTGAGGAGG - Intronic
950037018 3:9893514-9893536 CCTTTTGCCATCTGCTGAGGTGG + Exonic
951599510 3:24357676-24357698 TTTATTGTCCACTTCTGAGGGGG + Intronic
952126190 3:30303795-30303817 CATTTTGCCCACAGCTAAGATGG + Intergenic
956332365 3:68125710-68125732 CATTTTAGCCACTGCTGTGGTGG + Intronic
956533957 3:70254555-70254577 TATTTTCCCTAATGGTGAGGTGG + Intergenic
958946559 3:100368952-100368974 TATTTTGGCCACTGAGGAAGGGG - Intronic
959728245 3:109570112-109570134 TATTTAGCCCACTGGGGAGTTGG + Intergenic
960529427 3:118746386-118746408 GAGTTTCCCGACTGCTGAGGTGG - Intergenic
961930710 3:130529904-130529926 TGTGCTGCCCTCTGCTGAGGAGG - Intergenic
964877148 3:161380403-161380425 TTTTCTGCTCACTGTTGAGGAGG + Intergenic
969761397 4:9186489-9186511 TATATTGCTCAGAGCTGAGGAGG - Intergenic
972059200 4:34847175-34847197 TATTTATCCCACTCCTGAGAGGG + Intergenic
976923397 4:90466311-90466333 GATGTTCCCCACTGCTGAGATGG + Intronic
977171087 4:93763351-93763373 TTTTTTCCCCACTGCTCAGTAGG + Intronic
978139136 4:105297673-105297695 TCTGTTGACCATTGCTGAGGAGG - Intergenic
979559274 4:122083830-122083852 TATTTTGAACACTGCTAAGAGGG + Intergenic
979651753 4:123141726-123141748 TTTTTTGCCCACTTTTGAGCTGG + Intronic
983296945 4:165878395-165878417 TATTTTGGCGACTTCTGAGTTGG - Intronic
986413565 5:7505994-7506016 TTTTTTCCCCACTTCTGAGATGG + Intronic
986551038 5:8955970-8955992 TATTTTGGCCTCTGGAGAGGAGG + Intergenic
986720868 5:10560832-10560854 TATATTCCCCACTGCTCGGGAGG - Intergenic
987452182 5:18099295-18099317 TATTTTAACCCCTGCTGTGGTGG - Intergenic
988187012 5:27878383-27878405 TATTTTGCCTACTGATGTGATGG + Intergenic
989624663 5:43417745-43417767 CATTTTGCCCAGTGCAGAGATGG - Intergenic
991488856 5:67164708-67164730 TCTTTTTCCCACTGCTGCTGGGG - Exonic
992218489 5:74548319-74548341 TATTTGGTCCACTGGTGGGGAGG + Intergenic
996701404 5:126453757-126453779 AATTTTCCCCACTGCTGAATTGG - Intronic
996964649 5:129293622-129293644 TTTTTTACCCAGTGCTAAGGAGG + Intergenic
997173270 5:131747097-131747119 TATTTTGCCCACTGTTTATTGGG + Intronic
999259724 5:150230551-150230573 TATTTTGGCCAGTGCTGACAAGG - Intronic
1000911318 5:167026200-167026222 GATTTTGCCCACTGCAGTGTTGG + Intergenic
1005256114 6:24005137-24005159 TATTTCGCCTACTGCTCTGGAGG + Intergenic
1006071864 6:31504167-31504189 TATTTTGCCCATTTTTGAGTGGG + Intronic
1006943231 6:37766535-37766557 TATTTTGCCAAGTGCTTAGTTGG + Intergenic
1011670050 6:89674564-89674586 TCTCTTGCACACAGCTGAGGAGG + Exonic
1015657329 6:135533590-135533612 TAATTTGACAACTGCTGAGAAGG + Intergenic
1015733139 6:136368351-136368373 TAGTTTCCACAATGCTGAGGGGG + Intronic
1018240887 6:161773378-161773400 AATTGTGCCAACTGCTGACGAGG + Intronic
1022377543 7:29828725-29828747 TATTTAGCCCACCTCTGAGTGGG + Intronic
1023158082 7:37271647-37271669 TAGATTTCCCACTGCAGAGGAGG - Intronic
1027529139 7:79308464-79308486 TATTTGGGCCACTGATGTGGAGG - Intronic
1028908685 7:96183393-96183415 TATTTAGTACTCTGCTGAGGTGG - Intronic
1029318385 7:99735305-99735327 TTATTTGCCAACTGCCGAGGTGG - Intergenic
1029732088 7:102445172-102445194 GCTTTTGGCCTCTGCTGAGGAGG + Intronic
1031994609 7:128221515-128221537 GACTGTGCCCACTGCTGTGGGGG + Intergenic
1033149042 7:138897225-138897247 TTTTTTGCTCACTGCTTTGGAGG + Intronic
1034132549 7:148733711-148733733 TCCTTTGCCAACTGCTGATGAGG - Intronic
1034315765 7:150131477-150131499 TATTTTGCAGAGTTCTGAGGAGG - Intergenic
1034791125 7:153969326-153969348 TATTTTGCAGAGTTCTGAGGAGG + Intronic
1039151717 8:34514031-34514053 TATTTTGACCACAGGTGAAGAGG + Intergenic
1040889533 8:52302497-52302519 TGGTGTGCCCACTGCTGTGGAGG - Intronic
1040986865 8:53304862-53304884 TATTTTGCCCGTTTCTGATGAGG - Intergenic
1046339046 8:112827336-112827358 TATTTTATCCAATGCTGAGATGG + Intronic
1046714902 8:117556958-117556980 GATTTGGCCCAATTCTGAGGTGG + Intergenic
1046797636 8:118390126-118390148 TATTTTCCCAGCTGCTTAGGAGG - Intronic
1047363621 8:124192454-124192476 TATAAGGCCCATTGCTGAGGAGG - Intergenic
1047662566 8:127053622-127053644 TATTTTATCCACTGCCAAGGGGG + Intergenic
1053000409 9:34574534-34574556 TATTCTGCCCCCTTCTAAGGAGG - Intronic
1053607322 9:39673603-39673625 TATTTTGCCCATGGGTGAGACGG + Intergenic
1053865175 9:42429956-42429978 TATTTTGCCCATGGGTGAGATGG + Intergenic
1054246212 9:62668806-62668828 TATTTTGCCCATGGGTGAGACGG - Intergenic
1054560333 9:66703339-66703361 TATTTTGCCCATGGGTGAGACGG - Intergenic
1055078358 9:72241135-72241157 TATTTTACCTACTGCAGACGTGG + Exonic
1055864567 9:80797460-80797482 TATATTACCCACTTTTGAGGAGG + Intergenic
1056967666 9:91178515-91178537 TGTTTAGCCCACAGCTGAGAAGG - Intergenic
1059534725 9:115070098-115070120 TATTCTGCTCACTGATGGGGAGG + Intronic
1060029364 9:120201131-120201153 TATAGTGCCAACTGCTCAGGAGG + Intergenic
1187161518 X:16769483-16769505 CATTTTGCCCACTGCCCAGATGG - Intergenic
1188859013 X:35234383-35234405 TACTTTGCTCATTGCTGAGCAGG + Intergenic
1189243111 X:39540954-39540976 TTTTTTCCCCATGGCTGAGGTGG + Intergenic
1196861254 X:120029585-120029607 TAGATTGCCAAATGCTGAGGGGG + Intergenic
1197095461 X:122589263-122589285 CATTTTGCTCCCTGCTTAGGAGG + Intergenic
1197714229 X:129694770-129694792 TGTAGTCCCCACTGCTGAGGAGG + Intergenic
1198499321 X:137227082-137227104 CATTTTTCCTACTCCTGAGGTGG - Intergenic
1199197922 X:145054011-145054033 TATTTTGCCCACTTTTTAGTGGG - Intergenic
1200361277 X:155609698-155609720 TATTTTGCCCATTTCTGATTAGG - Intronic
1202168428 Y:22016440-22016462 GCTTTTGCTCACTGCTGAGCTGG - Intergenic
1202222933 Y:22569928-22569950 GCTTTTGCTCACTGCTGAGCTGG + Intergenic
1202320182 Y:23625732-23625754 GCTTTTGCTCACTGCTGAGCTGG - Intergenic
1202550585 Y:26044324-26044346 GCTTTTGCTCACTGCTGAGCTGG + Intergenic