ID: 949353758

View in Genome Browser
Species Human (GRCh38)
Location 3:3155151-3155173
Sequence TGCCATAATCCCTATGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949353758_949353762 21 Left 949353758 3:3155151-3155173 CCCAGTCCATAGGGATTATGGCA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 949353762 3:3155195-3155217 TGCTATCTACATACCTTACTTGG 0: 1
1: 0
2: 0
3: 15
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949353758 Original CRISPR TGCCATAATCCCTATGGACT GGG (reversed) Intronic
903027079 1:20437066-20437088 TGCCACAATCCCTAAAGACCTGG + Intergenic
912586795 1:110774301-110774323 TGCCATAATCCATGTTGACAAGG + Intergenic
913464236 1:119123265-119123287 TGCCATAGTGCCAATTGACTTGG - Intronic
914769016 1:150667029-150667051 TCCCACAATCCCTCTGTACTTGG - Intronic
917651899 1:177085928-177085950 TGCCACTAACCCAATGGACTTGG - Intronic
919546309 1:198923888-198923910 TGCTATAATGCCTATGGGATAGG - Intergenic
922771183 1:228184033-228184055 AGCCATCATCCCCAGGGACTCGG + Intergenic
922805313 1:228383689-228383711 TTCCATAATCCAAAAGGACTGGG - Intergenic
1070501629 10:77078155-77078177 GGCCATATTCCCTATGAAATAGG - Intronic
1077856424 11:6130785-6130807 TGCCATAATGCCTTGTGACTGGG - Intergenic
1080907812 11:36564340-36564362 CCCCATAATTCCTATAGACTAGG - Intronic
1083667111 11:64281621-64281643 TCCCATCATCCCTGTGGCCTTGG + Intronic
1084417259 11:69040116-69040138 TCCCATAATCCCTATGTTGTGGG - Intergenic
1094367933 12:29703935-29703957 TCCCATAATCCCCATGTAATGGG + Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1105720657 13:23110883-23110905 TGTCATAATTCCCATGGACGTGG - Intergenic
1107057629 13:36124361-36124383 TGCCAACATGCCTGTGGACTTGG - Intronic
1111110596 13:83703791-83703813 TGCTATAATCCCTCTGGCATAGG - Intergenic
1121471365 14:94156916-94156938 CACCATAATCCCAATGGCCTTGG + Intronic
1122102652 14:99425573-99425595 TGCCATAATCGCTTTGTACACGG + Intronic
1129946109 15:79540587-79540609 GGGCATAATCCTTATGGATTTGG - Intergenic
1137725928 16:50656625-50656647 TGCAACAATCCCTAAGGACTTGG - Intergenic
1142597060 17:1035061-1035083 TCCCTTCCTCCCTATGGACTGGG + Intronic
1146614391 17:34342027-34342049 TGCCTGACTTCCTATGGACTGGG - Intergenic
1148318641 17:46728479-46728501 TGCCATAATCCCACTGTACTCGG - Intronic
1148476755 17:47933721-47933743 TGCCATATTCCCTTTTGCCTGGG - Intergenic
1150949745 17:69789806-69789828 TTTCAGAATCACTATGGACTAGG - Intergenic
1151189108 17:72384904-72384926 TGACAGAATCCCCAGGGACTGGG + Intergenic
1151276592 17:73038994-73039016 TCCCATAATAAATATGGACTTGG - Intronic
1159611562 18:70531547-70531569 TCCCATAATCCCCATGTATTGGG + Intergenic
925547634 2:5035373-5035395 TGTCATTATCTCTATGAACTTGG - Intergenic
925964861 2:9055130-9055152 TGACATAACCCCTATGTACTTGG + Intergenic
926458685 2:13100663-13100685 TCCCATAATTCCTATGTATTGGG + Intergenic
930474109 2:51857435-51857457 TGCTAAAATGACTATGGACTTGG - Intergenic
935385373 2:102493594-102493616 TCCCATAATCCCTATGTGTTAGG - Intronic
940080822 2:149799145-149799167 TGCCCTAATCCCTAGAGAATGGG + Intergenic
940392981 2:153154164-153154186 TCCCATAATTCCCATGGACCTGG + Intergenic
941568781 2:167142847-167142869 TGCCCTAATCCTTAGTGACTGGG - Intronic
942480599 2:176384211-176384233 TGACTGACTCCCTATGGACTGGG - Intergenic
945544188 2:211128619-211128641 TCCCATGATGCATATGGACTTGG - Intergenic
946124711 2:217552479-217552501 TGACATAATCCCTGTGCTCTAGG - Intronic
947316191 2:228861835-228861857 TACCTTAATCCCTTTGCACTCGG - Intronic
1170870593 20:20202468-20202490 GACCATAATCCCCATGGAATGGG + Intronic
949353758 3:3155151-3155173 TGCCATAATCCCTATGGACTGGG - Intronic
952656575 3:35793500-35793522 TGTCATTATCGCAATGGACTAGG + Intronic
952710499 3:36427123-36427145 TGCAAAATTCCCTGTGGACTTGG - Intronic
956858888 3:73303039-73303061 TGAAATAATCACTATGGCCTGGG + Intergenic
967512276 3:190325204-190325226 TGCCATATTCAATATGAACTTGG - Intronic
969099554 4:4758569-4758591 TTCCATCATCCCCATGGCCTGGG - Intergenic
970173326 4:13310524-13310546 TGTCATCATCCCTATGCTCTGGG + Intergenic
972203360 4:36742182-36742204 TGCCAAAGTCCATATGGAATTGG + Intergenic
985699544 5:1362212-1362234 TTCCATTGTCCCCATGGACTTGG - Intergenic
988785754 5:34564356-34564378 TGCCCTAATCCCCACGGCCTGGG + Intergenic
989685253 5:44078104-44078126 TGCCATCAGCCCTCTAGACTGGG - Intergenic
994199751 5:96959161-96959183 TGTCCTAATCCCTAGGGACACGG - Intronic
995433336 5:112106942-112106964 GGCTATATACCCTATGGACTAGG + Intergenic
995993965 5:118277294-118277316 TCCCAAAATTCCTATGCACTAGG + Intergenic
1007547404 6:42704839-42704861 TTCTATACTCCCTATTGACTTGG - Intronic
1007548149 6:42709582-42709604 TTCTATATTCCCTATTGACTTGG - Intronic
1011669778 6:89672071-89672093 TGCCAAAATCACTAAGAACTTGG - Intronic
1018093800 6:160367367-160367389 TCCCATAATCCCCATGAACTTGG - Intronic
1018101947 6:160447707-160447729 TGCCAGGATACCTATGGAATAGG - Exonic
1018239692 6:161761103-161761125 GGCCATAATACCTTAGGACTGGG - Intronic
1018574323 6:165243485-165243507 GGCCATAATCCCTAAGCCCTAGG - Intergenic
1022862634 7:34383684-34383706 TGCCATAATTCCCATGTATTGGG + Intergenic
1024441490 7:49424031-49424053 TATAATAATCCCTATGAACTAGG - Intergenic
1029524527 7:101086931-101086953 TGCCACAAGGCCTGTGGACTGGG + Intronic
1037796576 8:22000400-22000422 TGACAGAAACCATATGGACTAGG - Intronic
1038125315 8:24666877-24666899 TCCCATAATTCCCATGTACTGGG - Intergenic
1045733391 8:105267277-105267299 TGGCAGAATCCCTATGGACCAGG - Intronic
1047601667 8:126431864-126431886 TGCGATTATCCCTTTGGGCTTGG - Intergenic
1052363114 9:27581236-27581258 TGCCTTAATCATTACGGACTAGG + Intergenic
1053146291 9:35714404-35714426 TGCCATCCTCCCTCTGGGCTTGG + Intronic
1187928373 X:24271326-24271348 TCCCATAATCCCTATGTCATGGG + Intergenic
1188426962 X:30059795-30059817 TGCCATTATCCTCATGGATTTGG - Intergenic
1195486804 X:105417843-105417865 TGTCATATTCTCTATGGACTGGG - Intronic