ID: 949353774

View in Genome Browser
Species Human (GRCh38)
Location 3:3155376-3155398
Sequence TGTGGGCAGTGATTCATTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949353771_949353774 -8 Left 949353771 3:3155361-3155383 CCAGGACTCCAGATTTGTGGGCA 0: 1
1: 0
2: 1
3: 19
4: 251
Right 949353774 3:3155376-3155398 TGTGGGCAGTGATTCATTAAGGG 0: 1
1: 0
2: 0
3: 12
4: 191
949353770_949353774 -7 Left 949353770 3:3155360-3155382 CCCAGGACTCCAGATTTGTGGGC 0: 1
1: 0
2: 0
3: 8
4: 146
Right 949353774 3:3155376-3155398 TGTGGGCAGTGATTCATTAAGGG 0: 1
1: 0
2: 0
3: 12
4: 191
949353766_949353774 23 Left 949353766 3:3155330-3155352 CCTTTAGTGTCGTGCATGTTGTT 0: 1
1: 0
2: 0
3: 5
4: 152
Right 949353774 3:3155376-3155398 TGTGGGCAGTGATTCATTAAGGG 0: 1
1: 0
2: 0
3: 12
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949353774 Original CRISPR TGTGGGCAGTGATTCATTAA GGG Intronic
901489023 1:9586874-9586896 TGTGGGTAGTGATGGATTGAGGG - Intergenic
903767060 1:25741752-25741774 TGTGGGCAATGAGCCATTAGAGG + Intronic
904220073 1:28960054-28960076 AGTGGGCAGTGATTGAGTCACGG - Intronic
904989510 1:34580366-34580388 TGTGGGAAGTGGTTCAGAAAAGG - Intergenic
909873084 1:80768299-80768321 ATTTGGCAGTGATTTATTAATGG - Intergenic
913012678 1:114699969-114699991 TGTGGGCATTGAGGCATTGAAGG - Intergenic
918207926 1:182325827-182325849 TGGGGGCAGTTTTTCATGAATGG + Intergenic
919891880 1:201981806-201981828 TGTAGGGAGTTTTTCATTAAGGG - Intergenic
922059809 1:222077584-222077606 TGTTGGTATTGATTTATTAAGGG + Intergenic
922060147 1:222081394-222081416 TGTTGGTATTGATTTATTAAGGG + Intergenic
923105797 1:230852404-230852426 GGGGGGCAGTCATTCTTTAATGG + Intronic
924813945 1:247426616-247426638 TGTGGGCAGTCAGTCCTTCATGG - Intronic
1062797252 10:353811-353833 TGTGTGGAGTGATTCATCACTGG + Intronic
1065277853 10:24104039-24104061 TGTGGGGATTCATTCATTACTGG + Intronic
1066111669 10:32202805-32202827 GATGGGAAGAGATTCATTAAAGG - Intergenic
1071025190 10:81104532-81104554 TGTGGGCAGTGAGTATTTATAGG + Intergenic
1072774268 10:98173668-98173690 AGTGGGCAGTGATTAATCACAGG + Intronic
1074496560 10:113984616-113984638 TGTGGTCAGTCATTGGTTAAGGG - Intergenic
1075414845 10:122255109-122255131 TGTCTGCAGTGATTTGTTAATGG - Intergenic
1075670454 10:124260750-124260772 TGTGGGCTGTGATCCATGGAAGG + Intergenic
1077063016 11:626002-626024 TGTGGTCAGTGTTTCTGTAAGGG - Exonic
1078113050 11:8415392-8415414 TTTGGCCAGTGATTCATGATTGG + Intronic
1078824813 11:14919185-14919207 TGGGGGCAGTTACTCATGAATGG + Intronic
1081855240 11:46299209-46299231 TGTGGGTGGTGACTCATTAATGG - Intronic
1086406394 11:86502827-86502849 TGTGGGCAATAATTCAGAAAAGG - Intronic
1087576114 11:99991842-99991864 TGTTCACAGTGATTCATGAATGG - Intronic
1088445252 11:109919620-109919642 TTTGGGAAGTGATTCAGTGATGG - Intergenic
1089023053 11:115238220-115238242 TGTGGTGAGTGATTCATTTGAGG + Intronic
1093374657 12:18410011-18410033 TGTGGGAGGTGATTCACTCATGG - Intronic
1096799026 12:54097147-54097169 TTTGGGCAGTGTCACATTAAAGG + Intergenic
1100204540 12:92334092-92334114 AATGGGGAGAGATTCATTAAAGG - Intergenic
1101142797 12:101813259-101813281 TGTGGGCTGTAATTTAATAATGG - Intronic
1101272319 12:103160664-103160686 TATGGGCTGGGATTCAATAAGGG - Intronic
1101565034 12:105897005-105897027 TGTGCACAGTAATTTATTAAGGG - Intergenic
1102622850 12:114210482-114210504 TGTGAGCAGTGAATCCTAAATGG - Intergenic
1103496919 12:121370136-121370158 AGTGGGCAGTGATTGCTTAATGG - Intronic
1106504693 13:30360938-30360960 TGTGGGCAGGGACTCCTTAGAGG - Intergenic
1108937808 13:55906718-55906740 GGTGGGCAGTGATTGAATCATGG + Intergenic
1109906361 13:68846812-68846834 GGTGGGCAGTGATTGACTCATGG + Intergenic
1110112469 13:71765361-71765383 TGTGGTCACTGTTTCAGTAAAGG + Intronic
1110502912 13:76249789-76249811 TGGGGGCAGTTTCTCATTAATGG + Intergenic
1110685069 13:78362832-78362854 TATGGGCACTGATCCATTCATGG + Intergenic
1113452527 13:110421569-110421591 AATGGGGAGTGATTGATTAATGG + Intronic
1113762750 13:112861191-112861213 GGTGGGCAGTGATTGAGTCATGG - Intronic
1114178624 14:20346028-20346050 GGTGGGAAGTGATTCAATCATGG - Intronic
1114274754 14:21132720-21132742 GGTGGGAAGTGATTGATTATGGG - Intergenic
1116650417 14:47584774-47584796 TGTAGGCAATGATTAATTCATGG - Intronic
1118540894 14:66823560-66823582 TCTGTGCAATGATTAATTAATGG - Intronic
1119591744 14:75895307-75895329 TGTGAGCTGTGATTCATAATTGG - Intronic
1119686823 14:76639757-76639779 TGTGGTCAGTGCTCTATTAAAGG - Intergenic
1120979806 14:90279791-90279813 TGTGGGCTGTGATTCCTTGGAGG - Intronic
1121548592 14:94781100-94781122 TGAAGGAAGTTATTCATTAAGGG + Intergenic
1123390820 15:19870262-19870284 GGTGGGAAGTTATTCTTTAATGG + Intergenic
1126885194 15:53141629-53141651 TGTGGGAAGTGATTGAATTATGG + Intergenic
1127940077 15:63686005-63686027 TGTGGGCACTGAATCTCTAATGG + Intronic
1130554917 15:84915830-84915852 TGTGGTCAGTGTGTCATTAAAGG - Intronic
1131630110 15:94167264-94167286 TGTGGGAGGTGATTGAATAATGG + Intergenic
1131649627 15:94384560-94384582 TGTGGGCAGAGAATCACTATGGG - Intronic
1133065155 16:3200958-3200980 TGTGGGGAGTTATTGCTTAATGG - Intergenic
1133364011 16:5196775-5196797 TGTGGGCAGTGGTTCTCCAAGGG - Intergenic
1135466479 16:22690633-22690655 TGTGGGCAGAGATTAAGTAGGGG - Intergenic
1137526585 16:49241724-49241746 AGTGGGCAGTGATTGAATTATGG - Intergenic
1138164440 16:54787933-54787955 TGTCAGTATTGATTCATTAATGG - Intergenic
1138326748 16:56178619-56178641 AGTGGGCAGTTATTGTTTAATGG - Intergenic
1141364878 16:83433419-83433441 TGTGGGCTATCATTCATTACTGG + Intronic
1144640991 17:16936410-16936432 GGTTGGCTGTGATTAATTAAAGG + Intronic
1144874091 17:18388107-18388129 GGTTGGCTGTGATTAATTAAAGG - Intronic
1145158129 17:20556309-20556331 GGTTGGCTGTGATTAATTAAAGG + Intergenic
1147498674 17:40941837-40941859 TGTGGGCAGTGGTGCAATCATGG + Intergenic
1147507840 17:41038013-41038035 TATGGGAAGTGATTGCTTAAAGG - Intergenic
1148688002 17:49511571-49511593 TGTGGGCAGTGACATATAAAAGG - Intronic
1149053609 17:52335988-52336010 TATGAGCAGGGATTCATTAGAGG - Intergenic
1149192563 17:54081860-54081882 TGTGGGAGGTGATTTGTTAATGG - Intergenic
1149456217 17:56790765-56790787 TGGGGGCAGTTTCTCATTAATGG + Intergenic
1149975304 17:61259702-61259724 AGTGGGCAGTCGTTCATTACTGG + Intronic
1150985912 17:70196980-70197002 TGTGGGCAGTGATTAACTCCTGG - Intergenic
1153574037 18:6503001-6503023 TGTGGGCAGTGATTAGATCATGG + Intergenic
1159199106 18:65160431-65160453 TTTTGACAGTGATTCTTTAATGG + Intergenic
1159966685 18:74601761-74601783 GGTGGGCAGTGATTGAATTATGG - Intronic
1160480633 18:79236970-79236992 TGTGGACACTGATTCATGCACGG - Intronic
1162646440 19:12053463-12053485 AGCTGGCAGTGCTTCATTAACGG - Intergenic
1165179465 19:33955346-33955368 TGTGGGCAATAATTGATTCATGG - Intergenic
1165615244 19:37193727-37193749 GGTGTGCAGTGGTGCATTAACGG - Intronic
925625172 2:5835854-5835876 TGCAGGCACTGATTCATTTATGG + Intergenic
926408951 2:12581931-12581953 TGTGGGCAGTTCATCATTCAGGG - Intergenic
926544391 2:14221236-14221258 TGTGGGGAGTGATTTATTTCAGG - Intergenic
927745490 2:25616007-25616029 TGTTGGCAGTGATAAATCAAAGG + Intronic
930477827 2:51906285-51906307 TATGGGTAGTCATTCTTTAATGG + Intergenic
933105363 2:78317829-78317851 TGTGGTCATTGAGTCATTCAGGG - Intergenic
934585168 2:95485980-95486002 TGTGGTCAGTGTTTGATAAAGGG + Intergenic
934594294 2:95590753-95590775 TGTGGTCAGTGTTTGATAAAGGG - Intergenic
934788483 2:97034881-97034903 TGTGGTCAGTGTTTGATAAAGGG + Intergenic
935586957 2:104809375-104809397 TTTGGGAAGTGATTCAGTCATGG + Intergenic
936749601 2:115625541-115625563 TGTGGGCAGTTGTTGATAAAAGG + Intronic
937032691 2:118753517-118753539 AGTGAGCAGTGATTCAGAAAGGG + Intergenic
937086116 2:119173042-119173064 TGTGGGCATTCATGGATTAATGG + Intergenic
938689172 2:133771148-133771170 TGTGGGCAGAGGTTCCATAAGGG - Intergenic
939363029 2:141198373-141198395 TGGGGACAGTCTTTCATTAAAGG - Intronic
942720510 2:178947422-178947444 TCTGGGCAATGATGGATTAAAGG + Intronic
944116580 2:196193471-196193493 TGAGGGCAGTCAATCACTAAGGG - Intergenic
944469700 2:200039867-200039889 TTTGGGCCGTTATTCATTGATGG + Intergenic
947799403 2:232918978-232919000 TGTGAGCAGTGATTTGTAAATGG - Intronic
948058994 2:235030007-235030029 TGTGGCCAGTGATTGATTGAAGG + Intronic
1170288260 20:14736329-14736351 AGTGGGGAGTGATTGCTTAATGG + Intronic
1171091309 20:22288244-22288266 CGTGGGCAGTGAATCACTGAAGG - Intergenic
1171797396 20:29577202-29577224 TTTGGGCAGTGTCACATTAAAGG - Intergenic
1173691153 20:44962148-44962170 TCTTGCCAGTGATTCATCAAGGG + Intergenic
1173785289 20:45788759-45788781 TGGGGGCACTGAATAATTAAAGG + Intronic
1174979276 20:55374828-55374850 TGTGAACCATGATTCATTAAGGG - Intergenic
1175007586 20:55701784-55701806 TGTGGGAAGTGATTGGTTCATGG - Intergenic
1177008668 21:15705185-15705207 AGTGGGAGGTGATTCAATAATGG + Intergenic
1182462276 22:30491392-30491414 TGAGGGCAGAGATTCATTGTGGG - Intronic
949353774 3:3155376-3155398 TGTGGGCAGTGATTCATTAAGGG + Intronic
951937145 3:28034122-28034144 GGTGGGAAGTGATTCGATAACGG + Intergenic
952580998 3:34833279-34833301 TCTGGGAAGTGCTACATTAAAGG + Intergenic
952714602 3:36466970-36466992 TGTGGGCTGTGTGTCATAAATGG + Intronic
952816287 3:37450952-37450974 TGTGGGAAGTGAGTCAGGAAAGG + Intergenic
956940431 3:74154243-74154265 TGTGGGCAGTAATTCAATTATGG - Intergenic
957567776 3:81907057-81907079 AATGGGAAGTAATTCATTAATGG - Intergenic
957646170 3:82932053-82932075 TATAGGCAGTGATTGATCAATGG - Intergenic
959171241 3:102847215-102847237 AGTGGGAAGTGATTGAATAATGG - Intergenic
961561141 3:127731021-127731043 TGTAGGCAGTGTTTCCATAATGG + Intronic
962731878 3:138291047-138291069 TGAGGACAGTGATTCCTTAGTGG - Intronic
963306415 3:143658608-143658630 TGTGGGCAGAGATTTATTATGGG + Intronic
966463207 3:180200753-180200775 TGGGGCAAGGGATTCATTAAAGG - Intergenic
967645169 3:191913980-191914002 TGGGGGCAGTTTCTCATTAATGG + Intergenic
971078030 4:23173004-23173026 GGTGGGAAGTGATTCAATCATGG - Intergenic
972190297 4:36583458-36583480 CAGGGCCAGTGATTCATTAAAGG - Intergenic
973121853 4:46530640-46530662 TGTGGGAAGTGATTGAATCATGG - Intergenic
973936228 4:55849775-55849797 TGTGGTCACTGACTCAGTAAAGG + Intergenic
974084895 4:57249327-57249349 TGTGGGCAGTGAGTTGATAAAGG + Intergenic
975230366 4:71925017-71925039 TGTGGGAAGTGATTGAATAATGG + Intergenic
975591206 4:76001828-76001850 TGTGAGCAGTGATTCAATTTGGG + Exonic
976146488 4:82046222-82046244 TTTGGGAAGTGATTGATTTATGG + Intergenic
976237487 4:82914386-82914408 TGTGGAAAGTGATTCCTCAAAGG - Intronic
979996791 4:127440825-127440847 TGTGTCCAGTGTGTCATTAATGG - Intergenic
981053562 4:140336360-140336382 AATGGGCAGTGATTACTTAATGG - Intronic
984200016 4:176707458-176707480 TGTGGGCCATAATTCATAAAGGG + Intronic
986496380 5:8345742-8345764 TGTGGGAAGTAATTCAATTATGG - Intergenic
987883769 5:23785098-23785120 TCTGGGCAGTGAGGGATTAATGG - Intergenic
990063515 5:51682141-51682163 TGAGGGCACTGTGTCATTAATGG + Intergenic
991262877 5:64685811-64685833 TGTGGAGAGTGATTAATCAACGG + Intergenic
991514205 5:67415840-67415862 TTTGGGAGGTGATTCATTTATGG - Intergenic
993473133 5:88331192-88331214 GGTGTGCAGTGATGCAATAATGG - Intergenic
997065513 5:130554711-130554733 GGTGGGAAGTGATTGGTTAATGG - Intergenic
998522110 5:142810505-142810527 TGTGTGTAGTCATTTATTAAGGG + Intronic
1000809174 5:165839384-165839406 TGGGGACAGTGATGCAATAAGGG - Intergenic
1001194417 5:169658924-169658946 TGTTGGCAATGATTAATTATAGG - Intronic
1001629320 5:173163127-173163149 TGGGGACAGTGATTCCTTAAGGG + Intronic
1006533809 6:34681175-34681197 TGAGGTCAGTGATTCATAAGAGG - Intronic
1008037549 6:46761747-46761769 TGTGGGCAGTGATTCTGGGATGG + Intergenic
1008552293 6:52644592-52644614 TGTGGTCAGTGATTGGTTCAGGG + Intergenic
1010049675 6:71487933-71487955 TGAGGGCAGGGCCTCATTAATGG + Intergenic
1010740458 6:79496665-79496687 AGTGGGCAGGGATTGATAAAAGG + Intronic
1013646946 6:112153502-112153524 TGTGGGTAGGGATCGATTAATGG + Intronic
1013703671 6:112806269-112806291 TGTGGGTTCTGATTCATTAAAGG - Intergenic
1016519657 6:144932477-144932499 TAAGGGCACTGATACATTAAAGG + Intergenic
1017986615 6:159448291-159448313 TGTGGTCAGTGATATAATAAAGG - Intergenic
1018042727 6:159939559-159939581 TCTTGGCAGTGGTTCAGTAAGGG - Intergenic
1018719138 6:166559167-166559189 TGTGGGCAAGGATTCAGTAGAGG + Intronic
1018719148 6:166559246-166559268 TGTGGGAAGGGATTCAGTAGAGG + Intronic
1021997340 7:26193133-26193155 TGTGGGCAGTGCTCCATGTACGG - Intronic
1023974956 7:45021863-45021885 TGTGGGTTATGATTCATTAGTGG + Intronic
1024359582 7:48454641-48454663 TGTGGGTCGGGATTCATTCAGGG - Intronic
1024792902 7:52986309-52986331 TGTGGGAGGTAATTGATTAATGG + Intergenic
1024857707 7:53800928-53800950 TGTGGGAGGTGATTCATTCATGG + Intergenic
1026355312 7:69552237-69552259 TCTGGTCAGTGAGACATTAAGGG + Intergenic
1027134510 7:75614569-75614591 GGTGGGGAGTGATTGCTTAATGG + Intronic
1028473858 7:91232829-91232851 TGTGGGTGGTGATGAATTAACGG - Intergenic
1030350851 7:108484570-108484592 AATGGGGAGTGATTCCTTAATGG - Intronic
1030727673 7:112945156-112945178 TTTAGGCTGTGATTCATTAGAGG - Intergenic
1030889076 7:114975472-114975494 TGAGAGCAGTGGATCATTAAAGG + Intronic
1030983923 7:116218348-116218370 TGTGGCTAGAGATGCATTAATGG - Intronic
1033277397 7:139982727-139982749 TGTGGGCTGTGATCCTTTAGGGG - Intronic
1034046533 7:147934474-147934496 GGTGGGCAGTAATTCAATCATGG - Intronic
1036814383 8:11890360-11890382 GGTGGGCAGTGATTGAATAATGG + Intergenic
1037694850 8:21214630-21214652 TGTGCGCAGTTGTTCATTTAGGG - Intergenic
1046938336 8:119906923-119906945 TGTGGTGAGTGATTAATAAAAGG + Intronic
1046975166 8:120266818-120266840 TGTAGGAAGTGATTCTGTAAAGG - Exonic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1050078121 9:1886486-1886508 TGTCTGCAGTCATTAATTAATGG - Intergenic
1050087401 9:1980289-1980311 TGTGGCCAGTGGTTGTTTAAAGG - Intergenic
1053608364 9:39682734-39682756 TGTAGGAAGTCATTTATTAAAGG + Intergenic
1053788635 9:41670251-41670273 TTTGGGCAGTGTCACATTAAAGG + Intergenic
1053866204 9:42439098-42439120 TGTAGGAAGTCATTTATTAAAGG + Intergenic
1054156503 9:61644517-61644539 TTTGGGCAGTGTCACATTAAAGG - Intergenic
1054176920 9:61881590-61881612 TTTGGGCAGTGTCACATTAAAGG + Intergenic
1054245166 9:62659675-62659697 TGTAGGAAGTCATTTATTAAAGG - Intergenic
1054476274 9:65575526-65575548 TTTGGGCAGTGTCACATTAAAGG - Intergenic
1054559294 9:66694206-66694228 TGTAGGAAGTCATTTATTAAAGG - Intergenic
1054660615 9:67699216-67699238 TTTGGGCAGTGTCACATTAAAGG - Intergenic
1055768107 9:79687040-79687062 TGTGGGCAGAAATTTATTCAGGG - Intronic
1057842599 9:98498238-98498260 GGTGGGGAGTGATTGTTTAATGG + Intronic
1057950122 9:99363229-99363251 TGTGGGCAAAGATTCCGTAAGGG + Intergenic
1058098090 9:100886348-100886370 TGTGGGAAGTGATTCAGGGAAGG + Intergenic
1186491579 X:9977708-9977730 TGTGGGAAGAGATTTATTAGGGG + Intergenic
1187268407 X:17758351-17758373 TGTGGCCAGTGATACATACATGG + Intergenic
1188912964 X:35872843-35872865 TGGGGGCAGTTTCTCATTAATGG + Intergenic
1190474795 X:50815223-50815245 TGCGGGCAGTGAATTTTTAAAGG + Intergenic
1190868987 X:54409183-54409205 AGTGGGGAGTGATTGCTTAATGG + Intergenic
1196695975 X:118612163-118612185 TGTGGGCAGCAATTCATCCAAGG + Intronic
1198878716 X:141255630-141255652 TGTGGGAAGTGATTGAATCATGG + Intergenic
1201713700 Y:17020129-17020151 TGTGGGAAGTGACTACTTAATGG - Intergenic
1201906731 Y:19093088-19093110 TGTGGGAAGTGATTGAATCATGG + Intergenic