ID: 949354431

View in Genome Browser
Species Human (GRCh38)
Location 3:3163259-3163281
Sequence TGTATCACCTAAAACCTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949354430_949354431 3 Left 949354430 3:3163233-3163255 CCTGACGTATATGGGATGGAGTT 0: 1
1: 0
2: 0
3: 6
4: 36
Right 949354431 3:3163259-3163281 TGTATCACCTAAAACCTTTTAGG 0: 1
1: 0
2: 4
3: 17
4: 201
949354425_949354431 15 Left 949354425 3:3163221-3163243 CCCTGTAGATAACCTGACGTATA 0: 1
1: 0
2: 0
3: 1
4: 61
Right 949354431 3:3163259-3163281 TGTATCACCTAAAACCTTTTAGG 0: 1
1: 0
2: 4
3: 17
4: 201
949354426_949354431 14 Left 949354426 3:3163222-3163244 CCTGTAGATAACCTGACGTATAT 0: 1
1: 0
2: 0
3: 0
4: 49
Right 949354431 3:3163259-3163281 TGTATCACCTAAAACCTTTTAGG 0: 1
1: 0
2: 4
3: 17
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949354431 Original CRISPR TGTATCACCTAAAACCTTTT AGG Intronic
902884816 1:19396995-19397017 TCTGTCACCTGAAATCTTTTTGG + Intronic
907396807 1:54196491-54196513 TTTATCATTTAAAACATTTTAGG - Exonic
908326005 1:63024413-63024435 TGAATCAGCTGACACCTTTTAGG + Intergenic
908377080 1:63554288-63554310 TGTACCTCCTAAGAGCTTTTTGG - Intronic
908861336 1:68493236-68493258 TGTATGACATAAATCATTTTTGG + Intronic
914954215 1:152146495-152146517 TGTATCACCTAGAATATTTCAGG - Intergenic
915049991 1:153058666-153058688 TCAAACACCTAAAACCTGTTTGG - Intergenic
916434446 1:164764205-164764227 TGTAACTCCTAAAGCCTTTAGGG - Intronic
917475278 1:175363985-175364007 TGTTTCACTTGAAACCTTGTAGG + Intronic
919573306 1:199275648-199275670 GGTATCACCTTACACCTGTTAGG + Intergenic
922145993 1:222945041-222945063 TTTATCACTTAATCCCTTTTTGG - Intronic
923874382 1:238032180-238032202 GATATCACCTAATACCTATTGGG + Intergenic
924355172 1:243165641-243165663 TGTCTGACCTGAAACATTTTTGG + Exonic
924404488 1:243728558-243728580 TATTTCACCTAAAACTTTATGGG + Intronic
924574508 1:245267797-245267819 TGTGTCTCCTTAAACGTTTTGGG + Intronic
924812241 1:247413336-247413358 GGTACCACCTCAAACCTGTTAGG - Intergenic
1063981595 10:11457008-11457030 TGTATCTCCTTAAAACTGTTAGG + Intronic
1065104303 10:22365862-22365884 GGTATCACTTCATACCTTTTAGG + Intronic
1065855572 10:29827488-29827510 TGTTTCACCTACGACCTTCTGGG - Intergenic
1065932132 10:30489234-30489256 TGTATAAACTAAAATCATTTTGG - Intergenic
1071747658 10:88440094-88440116 TTTATCACATAAATCCTGTTAGG - Intronic
1071764142 10:88642903-88642925 TGTATCACATAGGACCTTATGGG - Intergenic
1072352276 10:94568413-94568435 TGTGTCATCTAAAACAATTTAGG + Intronic
1078343488 11:10520867-10520889 TGTATCACCTAACAATGTTTTGG - Intronic
1080941703 11:36925804-36925826 TGTATAACCAAATACATTTTAGG + Intergenic
1081381495 11:42421953-42421975 AGTCTCACCTTATACCTTTTAGG - Intergenic
1082647290 11:55743450-55743472 TGTATCAAATTGAACCTTTTTGG - Intergenic
1085982444 11:81741312-81741334 AGTATCACATCAAATCTTTTGGG - Intergenic
1087727959 11:101743941-101743963 TCTATCACCTCAAACCTCTGTGG + Intronic
1087771016 11:102210228-102210250 TCAAACACCTAAAATCTTTTTGG - Intronic
1088077023 11:105862368-105862390 TTTATCACCAAGGACCTTTTTGG + Intronic
1088111800 11:106270005-106270027 TGTATCACATAACAACCTTTCGG - Intergenic
1091514047 12:1160248-1160270 TGTATCACCTAAATCTTTTGGGG - Intronic
1091522512 12:1261097-1261119 TGTATCAATAAAAAACTTTTAGG - Intronic
1092561543 12:9619421-9619443 GGTATCACTTCAAACCTATTAGG - Intergenic
1093395526 12:18676758-18676780 TCTAACACCTATTACCTTTTAGG - Intergenic
1094612559 12:32008400-32008422 AGTATCACCTCACACCTGTTAGG + Intergenic
1095564441 12:43605404-43605426 TATATCACCTCACACCTATTAGG - Intergenic
1098572220 12:72001161-72001183 TGGATCACCTAAAACTCTTGTGG - Intronic
1099279682 12:80628214-80628236 TGTATCACCTAAAGTATTTTAGG - Intronic
1099330360 12:81277229-81277251 TGTAACACATATAACATTTTAGG + Intronic
1099731709 12:86512218-86512240 TATATCACCTTACACCTGTTAGG + Intronic
1102610596 12:114108594-114108616 TGGTTCACCTAAAACCTTTCAGG + Intergenic
1102642054 12:114375586-114375608 TATATCACCTTACACCTGTTAGG + Intronic
1103732953 12:123040514-123040536 TCTCTCACCTTTAACCTTTTAGG + Intronic
1105511277 13:21053590-21053612 TTTATCACCTTAGACCTTTGGGG - Intronic
1107211571 13:37862656-37862678 TGTATTATCTAAAACATATTTGG - Intronic
1107286065 13:38793611-38793633 CATTTTACCTAAAACCTTTTAGG - Intronic
1108389449 13:49933968-49933990 TGTATTACTTAAAACCACTTTGG - Intronic
1109134315 13:58627158-58627180 TGTCTCAGCGAAGACCTTTTTGG - Intergenic
1109287326 13:60425310-60425332 TGTATCACCTCACACCTATAAGG + Intronic
1110506896 13:76297635-76297657 TATATCACGTAAAGCCTCTTAGG + Intergenic
1110582678 13:77150166-77150188 TGTATCTCCTAGAACTCTTTGGG - Intronic
1110799264 13:79675982-79676004 TGTATTTCCTTAAATCTTTTTGG + Intergenic
1111442226 13:88294895-88294917 TGTAACAACCAAAACCTCTTTGG + Intergenic
1114797904 14:25737934-25737956 TTTATCAACTAAAAAGTTTTGGG - Intergenic
1115008915 14:28521084-28521106 AATATCACCTGAAACCTCTTAGG - Intergenic
1116247879 14:42440194-42440216 TGTATCATTTAAAAGCTTTGTGG - Intergenic
1116262979 14:42654550-42654572 TTTCTCTCCTAAAACCTTGTGGG - Intergenic
1117940075 14:60953819-60953841 GGTATCACCTCACACCTGTTAGG - Intronic
1126219925 15:46201054-46201076 TGTATCACTTCATACCTATTAGG - Intergenic
1126288383 15:47042926-47042948 GATATCACCTTACACCTTTTAGG - Intergenic
1126452014 15:48818693-48818715 TGTATAAAATAAAACCTTTGGGG + Intergenic
1126464217 15:48946289-48946311 TGAGCCACCTCAAACCTTTTTGG + Intronic
1126535804 15:49762639-49762661 GGTATCACCTGACACCTGTTAGG - Intergenic
1126590201 15:50331537-50331559 TGGATCACATAGAACCTTATAGG + Intronic
1126941138 15:53766948-53766970 TGTATCTTCTAAAAACCTTTTGG + Intergenic
1129511430 15:76126002-76126024 GATATCACCTCACACCTTTTAGG + Intronic
1130402320 15:83568714-83568736 TGTATAACCTAAAACCATACTGG - Intronic
1138846204 16:60569821-60569843 GATATCACCTGACACCTTTTAGG + Intergenic
1140259232 16:73362922-73362944 TATAGGACCTAAAACATTTTTGG + Intergenic
1142891133 17:2943819-2943841 TATATCACCTCAGACCTGTTAGG + Intronic
1146893152 17:36521666-36521688 TTTAATACCTAAAACCTTTGGGG + Intronic
1149360785 17:55893572-55893594 GGTATCACCTAACACCTGTAAGG - Intergenic
1149816155 17:59725949-59725971 TGTTTTACCCAAAACATTTTGGG - Intronic
1151085266 17:71373119-71373141 TGAATCTCCTAAAAACTTGTTGG - Intergenic
1153122934 18:1752960-1752982 TGTATCACCTCACACATGTTAGG + Intergenic
1153540833 18:6152426-6152448 GATATCACCTAACACCTGTTAGG - Intronic
1153735994 18:8068330-8068352 TGTATAACACAAAACATTTTAGG + Intronic
1155670493 18:28365117-28365139 AGTAGCACCCAAAGCCTTTTAGG + Intergenic
1156144253 18:34157092-34157114 TTTAACACATAAAACTTTTTTGG + Intronic
1156323542 18:36051298-36051320 TGGATCACCAAGACCCTTTTAGG - Intronic
1157793053 18:50549883-50549905 TGTATCACCTCAGATCTTTGTGG - Intergenic
1159209116 18:65293265-65293287 AGTTTCACCTAAAAGTTTTTTGG + Intergenic
1159282205 18:66300870-66300892 AGTAACACCTAAAGCCTTATTGG + Intergenic
1159446817 18:68551094-68551116 TGTATGAACTACAACCTTGTGGG - Intergenic
1163096266 19:15059623-15059645 CGTATCACCTCACACCTGTTGGG + Intergenic
1164025969 19:21352920-21352942 TGTCACATCTAAAAGCTTTTCGG + Intergenic
1165357472 19:35312696-35312718 TGTAACCCCTAATACCTTTTTGG - Intronic
1168494152 19:56836477-56836499 TTTATCACGTAAAATATTTTAGG + Intronic
926804267 2:16690180-16690202 ATTATCACCTAAATTCTTTTTGG + Intergenic
928381547 2:30822546-30822568 TGTGTGATCTAAAAACTTTTGGG + Intergenic
929756140 2:44767195-44767217 TGTTTCACTGAAAACTTTTTAGG + Intronic
930715090 2:54586313-54586335 TGAGTCACCTAAACCCTTTTTGG - Intronic
932627623 2:73310941-73310963 GGTATCACCTCATACCTGTTAGG - Intergenic
933440615 2:82308939-82308961 TGTATCACTTCACACCTGTTAGG + Intergenic
933471062 2:82724657-82724679 TTTACCACCTCAACCCTTTTTGG + Intergenic
933680689 2:85097398-85097420 TGTATTACATAAAACCTCTTTGG - Intergenic
933940911 2:87244448-87244470 AGTATAACCCAAAACCTTCTTGG - Intergenic
936352228 2:111721565-111721587 AGTATAACCCAAAACCTTCTTGG + Intergenic
936708722 2:115106074-115106096 TCCATCACCTAAAACTGTTTTGG + Intronic
939498560 2:142952001-142952023 TGAATCACCTAAAATTTTTCTGG - Intronic
940455355 2:153891264-153891286 TGACTGACCTAAATCCTTTTTGG - Intronic
940467751 2:154053458-154053480 TTTATGACCTAAAACTTTTCTGG + Intronic
943527550 2:189036678-189036700 TGTACCACGTAAAACCTGGTGGG - Exonic
944119918 2:196230062-196230084 TGTGTCACCTACAGCCTCTTTGG - Intronic
946542164 2:220696639-220696661 TGTAACACTTAAAACATCTTTGG + Intergenic
946611643 2:221464769-221464791 TGTAGCAACTAAAAGCTGTTGGG - Intronic
946660701 2:221996461-221996483 TTTACCTCCTAAAAGCTTTTAGG - Intergenic
947055799 2:226101754-226101776 TTTATCACCTCACACCTGTTAGG - Intergenic
1169824892 20:9756746-9756768 TGTCTCACATTAAACTTTTTTGG + Intronic
1170936328 20:20813079-20813101 TGTGTCTCCTAAAACTTTTTCGG - Intergenic
1171128821 20:22629162-22629184 TTTATCACCCAAAACCCATTTGG + Intergenic
1172332730 20:34086909-34086931 CGTATCACCTACAACTTTCTAGG + Intronic
1173031558 20:39365885-39365907 AGTATCACATAAAACCTTTTTGG + Intergenic
1173636091 20:44559382-44559404 TGTATCACTTACAAACCTTTTGG + Intronic
1177412352 21:20746880-20746902 TGTATCACCTATATCCTTTTAGG - Intergenic
1177412364 21:20746979-20747001 TGCATCACCTATATCCTTTTAGG - Intergenic
1177709712 21:24757495-24757517 TGTATCACTGCAAACTTTTTGGG + Intergenic
1178279741 21:31271192-31271214 TGGACCACCTACAACCTTTCAGG - Intronic
1178388050 21:32172089-32172111 GATATCACCTCACACCTTTTAGG + Intergenic
1182049621 22:27302747-27302769 TGTACCTCCTAAAACCTGGTGGG + Intergenic
1183171008 22:36188237-36188259 TGTATCAGCGAAGACCATTTTGG + Intergenic
949354431 3:3163259-3163281 TGTATCACCTAAAACCTTTTAGG + Intronic
949728988 3:7085148-7085170 TGTTTCACATTAGACCTTTTTGG + Intronic
951617602 3:24565929-24565951 GGTATCACCTCACACCTGTTAGG + Intergenic
953823139 3:46226420-46226442 AGTATCATCTAAAAGCTTTTTGG + Intronic
957722893 3:84027177-84027199 TGAATCACATAAAAACATTTTGG - Intergenic
960809828 3:121617293-121617315 TGTATCAATTAAAAAATTTTGGG + Intronic
961310191 3:125992496-125992518 GCTATCACCTAACACCTGTTAGG + Intergenic
964561943 3:158006831-158006853 TGTATCACTAAAAACTTTTAAGG - Intergenic
966843639 3:184109005-184109027 TGTATAAATTTAAACCTTTTTGG + Intergenic
966997844 3:185301165-185301187 AGTATCACCTCATACCTATTAGG - Intronic
969943833 4:10762373-10762395 TGTATCACCTAAAATCTCTGTGG - Intergenic
971330183 4:25675536-25675558 TGTATCTACTAAAAAATTTTAGG - Intronic
971832850 4:31719955-31719977 GGCATCACCTAAAAACTTGTTGG + Intergenic
971998884 4:34003119-34003141 TTTTTCACATAGAACCTTTTAGG + Intergenic
975200964 4:71589122-71589144 TGTCTCACTGTAAACCTTTTTGG + Intergenic
978392072 4:108237583-108237605 TATATGAGCTAAAACCTTTAGGG + Intergenic
978896590 4:113895793-113895815 TCTAAAACCTAAAACCATTTGGG - Intergenic
979246626 4:118513987-118514009 TGTCTGACCTGAAACATTTTTGG - Intergenic
979515603 4:121606352-121606374 GGTATCACCTCACACCTGTTAGG - Intergenic
979881199 4:125962172-125962194 GGTATCACCTCATACCTGTTAGG - Intergenic
981164259 4:141538848-141538870 TGTATCACCTCATACCTGTCAGG + Intergenic
982027543 4:151266060-151266082 TGTATTTACTAAAATCTTTTAGG - Intronic
982870494 4:160574013-160574035 TGCATCACCTAAAATCTGTCGGG + Intergenic
982956584 4:161776834-161776856 TGGATCACCTCAAACATTTATGG + Intronic
983506654 4:168560575-168560597 TGAATCACTTAAATCATTTTAGG - Intronic
984001705 4:174254065-174254087 TGTATCAGCTAAGATGTTTTTGG - Intronic
985020561 4:185684473-185684495 TTTTTAACCTAAAAACTTTTGGG - Intronic
1202754068 4_GL000008v2_random:40306-40328 TGCATCACATAAAAACATTTTGG + Intergenic
986609062 5:9548772-9548794 TGGCTCACCTAAAACAGTTTAGG - Intergenic
987264828 5:16242522-16242544 GGTATCACCTCAAACCTGTAAGG + Intergenic
988136634 5:27180175-27180197 TGTATCACTTAAAATAATTTTGG - Intergenic
989443476 5:41501005-41501027 GATATCACCTAATACCTGTTAGG + Intronic
989491718 5:42063193-42063215 GGTATCATCTCAAACCTATTAGG + Intergenic
990971852 5:61516321-61516343 TGTATCTCCTAGAATATTTTTGG + Intronic
991041018 5:62175681-62175703 TGTAACACTAAAAATCTTTTGGG - Intergenic
991055055 5:62311066-62311088 TTTATCTCCAAAAACCTTTCTGG - Intronic
993928745 5:93908495-93908517 TGTATTATCTAATACTTTTTAGG - Intronic
996438655 5:123464045-123464067 GGTATCACCTCACACCTGTTAGG - Intergenic
996816557 5:127580355-127580377 GGTATCACCTCACACCTGTTAGG + Intergenic
997958616 5:138300764-138300786 TATATGACTTAAATCCTTTTAGG - Intronic
999029112 5:148270151-148270173 TTTATCTCCCAAAACCTCTTAGG - Intronic
1007312671 6:40959109-40959131 GGTTCCACCTAAAACCTTTGTGG + Intergenic
1007867561 6:44989690-44989712 TGTATCACCTCACACCTATTAGG - Intronic
1010503670 6:76631229-76631251 ACTATCACCTCACACCTTTTAGG + Intergenic
1011132201 6:84063307-84063329 TGAATCATCTAAATCCTTTTGGG - Intronic
1011216593 6:85012352-85012374 TGTATCAACCAAAAACCTTTAGG + Intergenic
1016444040 6:144114483-144114505 TGTATAGCCAAAGACCTTTTGGG + Intergenic
1018642423 6:165916996-165917018 TGTTTCTCCTAAGACCTGTTGGG + Intronic
1026359917 7:69594007-69594029 TTTATCAACTATAATCTTTTGGG + Intergenic
1027878030 7:83796876-83796898 TATATCAGCTGAAACCTTTTTGG - Intergenic
1028003771 7:85535789-85535811 TGTATCAACTAAACACTCTTTGG - Intergenic
1031730575 7:125295016-125295038 TATATCACCTCACACCTATTAGG - Intergenic
1034297070 7:149983368-149983390 GGTATCACCTCACACCTATTAGG + Intergenic
1035904586 8:3495795-3495817 TGTAGGAACTAAAACCATTTTGG - Intronic
1037158566 8:15737929-15737951 TGTATTAACTGAAACATTTTTGG - Intronic
1038685252 8:29710787-29710809 TGTATCTCCAAAAAGTTTTTTGG + Intergenic
1038954209 8:32449738-32449760 TGTTTCAGCTAAATCTTTTTTGG + Intronic
1041833877 8:62189055-62189077 TGTATTCCATAAAACATTTTTGG - Intergenic
1042679367 8:71364808-71364830 TCTGTCACATAAAACCTGTTTGG - Intergenic
1043205970 8:77440622-77440644 TGTATCACCTAAAACATTTATGG + Intergenic
1044349331 8:91145230-91145252 TGTATCACTTTTAAACTTTTAGG - Intronic
1045394919 8:101750947-101750969 TATATCGCCTAAAAGGTTTTAGG + Intronic
1045394920 8:101750954-101750976 TATCATACCTAAAACCTTTTAGG - Intronic
1045712615 8:105002947-105002969 TATACCATATAAAACCTTTTGGG + Intronic
1046147006 8:110173447-110173469 TATATCACCTCACACCTATTAGG + Intergenic
1046167507 8:110456519-110456541 TATATCACCTCATACCTGTTAGG + Intergenic
1046705978 8:117452218-117452240 TGGATCAACTAAAACGTTTAGGG + Intergenic
1048127928 8:131657832-131657854 GGTATCACCTCACACGTTTTGGG - Intergenic
1048528537 8:135226743-135226765 TGGATTAGCTAAAACCTCTTGGG - Intergenic
1048626346 8:136189775-136189797 CATATCACTTAAAACCTTATAGG + Intergenic
1048714675 8:137254799-137254821 AGTGTCACCTGAAAGCTTTTAGG - Intergenic
1049132775 8:140862904-140862926 TGCTTTACCTAACACCTTTTTGG - Intronic
1049370976 8:142267109-142267131 TGCAACAGCTAAAATCTTTTGGG + Intronic
1051317447 9:15856901-15856923 GGTATCACCTCATACCTATTAGG - Intronic
1051555852 9:18381752-18381774 TGTATCACCGAGAACCCATTTGG + Intergenic
1052019203 9:23507053-23507075 GGTATCACCTCACACCTGTTAGG - Intergenic
1052559912 9:30071768-30071790 GGTATCACCTAAAACCTGCTAGG + Intergenic
1053395973 9:37774699-37774721 TGTATCGCTTAAAACATTTTTGG + Intronic
1056941348 9:90959174-90959196 TGTAACATCTGAAACATTTTGGG - Intergenic
1056978662 9:91285606-91285628 TTGATCACCTAAAATCTGTTAGG - Intronic
1057226175 9:93294448-93294470 GGTATGACCTAGAACCTTTTGGG + Intronic
1057240983 9:93408807-93408829 GATATCACCTCACACCTTTTAGG - Intergenic
1058113679 9:101059765-101059787 AGTATCACCTCACACCTGTTAGG + Intronic
1059625205 9:116056839-116056861 TATATCACCTCACACCTATTGGG + Intergenic
1187619371 X:21032993-21033015 GATATCACCTCATACCTTTTAGG + Intergenic
1187735905 X:22303462-22303484 TGTATCACCTAGCAGCTGTTTGG + Intergenic
1189451604 X:41137652-41137674 TGTATGACTTAAAATCTTTCTGG - Intronic
1192714921 X:73629017-73629039 TGTATTACCTAAAACCTATTAGG - Intronic
1194005157 X:88482457-88482479 TATATCACCTTAAACCTGTTAGG - Intergenic
1194073494 X:89358387-89358409 AATATCACCTAACACCTGTTAGG - Intergenic
1195500838 X:105597308-105597330 AGTATCACCTCACACCTGTTAGG + Intronic
1195528487 X:105922613-105922635 TGTATCATTTAACAACTTTTGGG - Intronic
1195884705 X:109625804-109625826 TATATCACCAGAAACCATTTTGG - Intronic
1195955101 X:110319992-110320014 TCTATCTCATAAAATCTTTTTGG - Intronic
1196632307 X:117955990-117956012 TTTTTCACCTAAAATGTTTTAGG + Intronic
1196651506 X:118172783-118172805 TGTTTTACCTAAGGCCTTTTAGG - Intergenic
1196676322 X:118424370-118424392 TATATCACCTCACACCTGTTAGG - Intronic
1196690524 X:118554238-118554260 TGTAGAGCTTAAAACCTTTTTGG + Intronic
1200728876 Y:6709968-6709990 AATATCACCTAACACCTGTTAGG - Intergenic
1200892801 Y:8341539-8341561 TATATCACATAAAGCCTTATTGG + Intergenic