ID: 949358680

View in Genome Browser
Species Human (GRCh38)
Location 3:3208718-3208740
Sequence CTGTGGTTGTCAGGGTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949358674_949358680 27 Left 949358674 3:3208668-3208690 CCAACTATATGACATTCTGCAAA 0: 6
1: 291
2: 713
3: 1127
4: 1368
Right 949358680 3:3208718-3208740 CTGTGGTTGTCAGGGTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949358680 Original CRISPR CTGTGGTTGTCAGGGTTTGA GGG Intergenic
No off target data available for this crispr