ID: 949358680 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:3208718-3208740 |
| Sequence | CTGTGGTTGTCAGGGTTTGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 949358674_949358680 | 27 | Left | 949358674 | 3:3208668-3208690 | CCAACTATATGACATTCTGCAAA | 0: 6 1: 291 2: 713 3: 1127 4: 1368 |
||
| Right | 949358680 | 3:3208718-3208740 | CTGTGGTTGTCAGGGTTTGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 949358680 | Original CRISPR | CTGTGGTTGTCAGGGTTTGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||